Untitled.ipynb

{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {
    "collapsed": true,
    "jupyter": {
     "outputs_hidden": true
    }
   },
   "outputs": [],
   "source": [
    "def f(a,**kwargs):\n",
    "    print(kwargs.get('pita'))\n",
    "    kwargs['pita']"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "import calour as ca"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "2021-04-07 17:19:46 WARNING Do you forget to normalize your data? It is required before running this function\n"
     ]
    }
   ],
   "source": [
    "xx=ca.read_amplicon('/Users/amnon/Projects/antlion/all.biom','/Users/amnon/Projects/antlion/map.txt',min_reads=1000,normalize=10000)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "<calour.heatmap.plotgui_qt5.PlotGUI_QT5 at 0x7fc14125ec10>"
      ]
     },
     "execution_count": 7,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "xx.plot(gui='qt5')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "lala\n"
     ]
    }
   ],
   "source": [
    "db=ca.database._get_database_class('dbbact')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'1.4.0'"
      ]
     },
     "execution_count": 9,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "db.version()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "aa\n"
     ]
    }
   ],
   "source": [
    "f(2,pita='aa')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "None\n"
     ]
    }
   ],
   "source": [
    "f(2)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [
    {
     "name": "stderr",
     "output_type": "stream",
     "text": [
      "/Users/amnon/miniconda3/envs/calour/lib/python3.5/site-packages/h5py/__init__.py:36: FutureWarning: Conversion of the second argument of issubdtype from `float` to `np.floating` is deprecated. In future, it will be treated as `np.float64 == np.dtype(float).type`.\n",
      "  from ._conv import register_converters as _register_converters\n"
     ]
    }
   ],
   "source": [
    "import dbbact_calour."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [],
   "source": [
    "a=dbbact_calour.dbbact_calour.DBBact()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "ename": "TypeError",
     "evalue": "string indices must be integers",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-7-395bc8d6b5c2>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0ma\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mdb\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mget_annotation_string\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m'TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG'\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;32m~/git/dbbact-calour/dbbact_calour/db_access.py\u001b[0m in \u001b[0;36mget_annotation_string\u001b[0;34m(self, cann)\u001b[0m\n\u001b[1;32m    180\u001b[0m         '''\n\u001b[1;32m    181\u001b[0m         \u001b[0mcdesc\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m''\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m--> 182\u001b[0;31m         \u001b[0;32mif\u001b[0m \u001b[0mcann\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;34m'description'\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m:\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m\u001b[1;32m    183\u001b[0m             \u001b[0mcdesc\u001b[0m \u001b[0;34m+=\u001b[0m \u001b[0mcann\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;34m'description'\u001b[0m\u001b[0;34m]\u001b[0m \u001b[0;34m+\u001b[0m \u001b[0;34m' ('\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m    184\u001b[0m         \u001b[0;32mif\u001b[0m \u001b[0mcann\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;34m'annotationtype'\u001b[0m\u001b[0;34m]\u001b[0m \u001b[0;34m==\u001b[0m \u001b[0;34m'diffexp'\u001b[0m\u001b[0;34m:\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n",
      "\u001b[0;31mTypeError\u001b[0m: string indices must be integers"
     ]
    }
   ],
   "source": [
    "a.db.get_annotation_string('TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [],
   "source": [
    "c=a.db.get_seq_annotation_strings('TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[({'annotationtype': 'other',\n",
       "   'sequence': 'TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG'},\n",
       "  'most: homo sapiens, feces, united states of america, adult, saliva, '),\n",
       " ({'annotationtype': 'other',\n",
       "   'sequence': 'TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG'},\n",
       "  'special: centenerians, nicotiana galuca, age <1 year, chronic gastritis, '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 6,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-10-06',\n",
       "   'description': 'Lower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'chronic gastritis'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'tongue'],\n",
       "    ['all', 'china']],\n",
       "   'expid': 3,\n",
       "   'id': 6,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 10,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'Lower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control  compared to chronic gastritis  in homo sapiens tongue china '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 7,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-10-06',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'tongue'], ['all', 'china']],\n",
       "   'expid': 3,\n",
       "   'id': 7,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 81,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, tongue, china,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 8,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-10-06',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'tongue'], ['all', 'china']],\n",
       "   'expid': 3,\n",
       "   'id': 8,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 30,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, tongue, china,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 13,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-10-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'urine'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'pregnancy'],\n",
       "    ['all', 'state of tennessee']],\n",
       "   'expid': 6,\n",
       "   'id': 13,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 201,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, urine, female, pregnancy, state of tennessee,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 26,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-10-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'], ['all', 'homo sapiens'], ['all', 'toronto']],\n",
       "   'expid': 10,\n",
       "   'id': 26,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 138,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, toronto,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 31,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-11-02',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'chronic fatigue syndrome'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'new york county']],\n",
       "   'expid': 12,\n",
       "   'id': 31,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 35,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to chronic fatigue syndrome  in feces homo sapiens new york county '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 35,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-11-08',\n",
       "   'description': '',\n",
       "   'details': [['high', 'stomach'],\n",
       "    ['high', 'duodenum'],\n",
       "    ['high', 'jejunum'],\n",
       "    ['high', 'ileum'],\n",
       "    ['low', 'feces'],\n",
       "    ['low', 'caecum'],\n",
       "    ['low', 'transverse colon'],\n",
       "    ['low', 'left colon'],\n",
       "    ['low', 'right colon'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'gastrointestinal system'],\n",
       "    ['all', 'mus musculus']],\n",
       "   'expid': 14,\n",
       "   'id': 35,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 42,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in stomach duodenum jejunum ileum  compared to feces caecum transverse colon left colon right colon  in united states of america gastrointestinal system mus musculus '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 56,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-11-14',\n",
       "   'description': 'higher in CD compared to control in biopsies',\n",
       "   'details': [['high', \"crohn's disease\"],\n",
       "    ['low', 'control'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'rectum'],\n",
       "    ['all', 'caecum'],\n",
       "    ['all', 'colon'],\n",
       "    ['all', 'sigmoid colon'],\n",
       "    ['all', 'terminal ileum'],\n",
       "    ['all', 'biopsy'],\n",
       "    ['all', 'children']],\n",
       "   'expid': 19,\n",
       "   'id': 56,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 34,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  \"higher in CD compared to control in biopsies ( high in crohn's disease  compared to control  in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children \"),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 58,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-11-14',\n",
       "   'description': 'common in biopsies of children (IBD study)',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'rectum'],\n",
       "    ['all', 'caecum'],\n",
       "    ['all', 'colon'],\n",
       "    ['all', 'sigmoid colon'],\n",
       "    ['all', 'terminal ileum'],\n",
       "    ['all', 'biopsy'],\n",
       "    ['all', 'children']],\n",
       "   'expid': 19,\n",
       "   'id': 58,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 40,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in biopsies of children (IBD study) (common  homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 59,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-11-14',\n",
       "   'description': 'high freq in biopsies of children (IBD study)',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'rectum'],\n",
       "    ['all', 'caecum'],\n",
       "    ['all', 'colon'],\n",
       "    ['all', 'sigmoid colon'],\n",
       "    ['all', 'terminal ileum'],\n",
       "    ['all', 'biopsy'],\n",
       "    ['all', 'children']],\n",
       "   'expid': 19,\n",
       "   'id': 59,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 16,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq in biopsies of children (IBD study) (highfreq  homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 69,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-01',\n",
       "   'description': 'appears on transition to cow milk',\n",
       "   'details': [['high', 'milk'],\n",
       "    ['low', 'breast milk'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant']],\n",
       "   'expid': 24,\n",
       "   'id': 69,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'appears on transition to cow milk ( high in milk  compared to breast milk  in feces homo sapiens infant '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 77,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['high', 'mucus'],\n",
       "    ['high', 'pair of nares'],\n",
       "    ['low', 'mouth'],\n",
       "    ['low', 'saliva'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'canis lupus familiaris']],\n",
       "   'expid': 26,\n",
       "   'id': 77,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 57,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in mucus pair of nares  compared to mouth saliva  in united states of america canis lupus familiaris '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 83,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['high', 'mucus'],\n",
       "    ['high', 'pair of nares'],\n",
       "    ['low', 'mouth'],\n",
       "    ['low', 'saliva'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'felis catus']],\n",
       "   'expid': 26,\n",
       "   'id': 83,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 86,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in mucus pair of nares  compared to mouth saliva  in united states of america felis catus '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 86,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'mucus'],\n",
       "    ['all', 'pair of nares'],\n",
       "    ['all', 'felis catus']],\n",
       "   'expid': 26,\n",
       "   'id': 86,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 80,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  united states of america, mucus, pair of nares, felis catus,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 89,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['high', 'mucus'],\n",
       "    ['high', 'pair of nares'],\n",
       "    ['low', 'sebum'],\n",
       "    ['low', 'axilla'],\n",
       "    ['low', 'inguinal region'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 26,\n",
       "   'id': 89,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 92,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in mucus pair of nares  compared to sebum axilla inguinal region  in homo sapiens united states of america '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 90,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mucus'],\n",
       "    ['all', 'pair of nares']],\n",
       "   'expid': 26,\n",
       "   'id': 90,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 73,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, mucus, pair of nares,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 92,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': 'common in combined swab of inguinal region and axilla',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'sebum'],\n",
       "    ['all', 'axilla'],\n",
       "    ['all', 'inguinal region']],\n",
       "   'expid': 26,\n",
       "   'id': 92,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 29,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in combined swab of inguinal region and axilla (common  homo sapiens, united states of america, sebum, axilla, inguinal region,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 103,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['high', 'seed'],\n",
       "    ['low', 'seedling'],\n",
       "    ['all', 'brassica oleracea'],\n",
       "    ['all', 'french republic']],\n",
       "   'expid': 29,\n",
       "   'id': 103,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 379,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in seed  compared to seedling  in brassica oleracea french republic '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 104,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'brassica oleracea'],\n",
       "    ['all', 'french republic'],\n",
       "    ['all', 'seed']],\n",
       "   'expid': 29,\n",
       "   'id': 104,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 146,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  brassica oleracea, french republic, seed,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 110,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'bolivia']],\n",
       "   'expid': 32,\n",
       "   'id': 110,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 17,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, infant, bolivia,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 111,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'bolivia']],\n",
       "   'expid': 32,\n",
       "   'id': 111,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 46,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, infant, bolivia,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 112,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'bolivia']],\n",
       "   'expid': 32,\n",
       "   'id': 112,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 116,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, adult, bolivia,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 113,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'bolivia']],\n",
       "   'expid': 32,\n",
       "   'id': 113,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 17,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, adult, bolivia,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 114,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-06',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'sputum'],\n",
       "    ['all', 'lung'],\n",
       "    ['all', 'bronchial epithelium'],\n",
       "    ['all', 'vancouver']],\n",
       "   'expid': 33,\n",
       "   'id': 114,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 40,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, sputum, lung, bronchial epithelium, vancouver,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 115,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-12-06',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'sputum'],\n",
       "    ['all', 'lung'],\n",
       "    ['all', 'bronchial epithelium'],\n",
       "    ['all', 'vancouver']],\n",
       "   'expid': 33,\n",
       "   'id': 115,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, sputum, lung, bronchial epithelium, vancouver,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 125,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-06',\n",
       "   'description': 'higher in adults compared to centenarians',\n",
       "   'details': [['high', 'adult'],\n",
       "    ['low', 'centenerians'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'sichuan province']],\n",
       "   'expid': 36,\n",
       "   'id': 125,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 16,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in adults compared to centenarians ( high in adult  compared to centenerians  in feces homo sapiens sichuan province '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 156,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2016-12-19',\n",
       "   'description': 'lower in young babies compared to 2 year olds in india',\n",
       "   'details': [['high', 'age'],\n",
       "    ['high', 'age 1-2'],\n",
       "    ['low', 'age 0-1'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'india']],\n",
       "   'expid': 45,\n",
       "   'id': 156,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 253,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in young babies compared to 2 year olds in india ( high in age age 1-2  compared to age 0-1  in feces homo sapiens infant india '),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 157,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2016-12-19',\n",
       "   'description': 'common in feces babies age 0-2 in india',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'india']],\n",
       "   'expid': 45,\n",
       "   'id': 157,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 31,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in feces babies age 0-2 in india (common  feces, homo sapiens, infant, india,'),\n",
       " ({'agent': 'heatsequer',\n",
       "   'annotationid': 158,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2016-12-19',\n",
       "   'description': 'high freq. in feces babies <2 years in india',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'india']],\n",
       "   'expid': 45,\n",
       "   'id': 158,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in feces babies <2 years in india (highfreq  feces, homo sapiens, infant, india,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 175,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-01-19',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'hypopharynx'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark']],\n",
       "   'expid': 48,\n",
       "   'id': 175,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 15,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, hypopharynx, infant, kingdom of denmark,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 194,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-01-21',\n",
       "   'description': '',\n",
       "   'details': [['high', 'el salvador'],\n",
       "    ['high', 'small village'],\n",
       "    ['low', 'lima'],\n",
       "    ['low', 'shantytown'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'city']],\n",
       "   'expid': 53,\n",
       "   'id': 194,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 296,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in el salvador small village  compared to lima shantytown  in feces homo sapiens city '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 198,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-01-21',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'city'],\n",
       "    ['all', 'el salvador'],\n",
       "    ['all', 'small village']],\n",
       "   'expid': 53,\n",
       "   'id': 198,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 155,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, city, el salvador, small village,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 201,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-01-21',\n",
       "   'description': 'lower in sewer and wastewater treatment plant influent compared to feces in south america',\n",
       "   'details': [['high', 'feces'],\n",
       "    ['high', 'homo sapiens'],\n",
       "    ['low', 'wastewater treatment plant'],\n",
       "    ['low', 'sewer'],\n",
       "    ['all', 'city'],\n",
       "    ['all', 'south america'],\n",
       "    ['all', 'low income']],\n",
       "   'expid': 53,\n",
       "   'id': 201,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 188,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens  compared to wastewater treatment plant sewer  in city south america low income '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 204,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva']],\n",
       "   'expid': 54,\n",
       "   'id': 204,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 78,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, saliva,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 205,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva']],\n",
       "   'expid': 54,\n",
       "   'id': 205,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 19,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, united states of america, saliva,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 207,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-01-30',\n",
       "   'description': '',\n",
       "   'details': [['all', 'nectar'],\n",
       "    ['all', 'israel'],\n",
       "    ['all', 'nicotiana galuca'],\n",
       "    ['all', 'flower']],\n",
       "   'expid': 56,\n",
       "   'id': 207,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 57,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  nectar, israel, nicotiana galuca, flower,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 211,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-02-02',\n",
       "   'description': '',\n",
       "   'details': [['high', 'conjunctiva'],\n",
       "    ['low', 'skin'],\n",
       "    ['low', 'skin under eye'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'new york city']],\n",
       "   'expid': 58,\n",
       "   'id': 211,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 96,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in conjunctiva  compared to skin skin under eye  in homo sapiens new york city '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 213,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-02',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'conjunctiva'],\n",
       "    ['all', 'new york city']],\n",
       "   'expid': 58,\n",
       "   'id': 213,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 28,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, conjunctiva, new york city,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 216,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-02',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'conjunctiva'],\n",
       "    ['all', 'new york city']],\n",
       "   'expid': 58,\n",
       "   'id': 216,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 10,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, conjunctiva, new york city,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 259,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'child'],\n",
       "    ['all', 'egypt'],\n",
       "    ['all', 'obsolete_juvenile stage']],\n",
       "   'expid': 62,\n",
       "   'id': 259,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 422,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, child, egypt, obsolete_juvenile stage,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 261,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'child'],\n",
       "    ['all', 'obsolete_juvenile stage']],\n",
       "   'expid': 62,\n",
       "   'id': 261,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 373,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america, child, obsolete_juvenile stage,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 263,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-02-15',\n",
       "   'description': '',\n",
       "   'details': [['high', 'female'],\n",
       "    ['low', 'male'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'skin']],\n",
       "   'expid': 63,\n",
       "   'id': 263,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 139,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in female  compared to male  in homo sapiens skin '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 265,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-15',\n",
       "   'description': 'common in skin in american gut',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'skin']],\n",
       "   'expid': 63,\n",
       "   'id': 265,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 56,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in skin in american gut (common  homo sapiens, skin,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 266,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-15',\n",
       "   'description': 'high freq. in skin in american gut',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'skin']],\n",
       "   'expid': 63,\n",
       "   'id': 266,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 13,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in skin in american gut (highfreq  homo sapiens, skin,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 267,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-15',\n",
       "   'description': 'common in saliva in american gut',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'saliva']],\n",
       "   'expid': 63,\n",
       "   'id': 267,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 32,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in saliva in american gut (common  homo sapiens, saliva,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 268,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-02-15',\n",
       "   'description': 'high freq. in saliva in american gut',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'saliva']],\n",
       "   'expid': 63,\n",
       "   'id': 268,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 15,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in saliva in american gut ( high in  compared to  in homo sapiens saliva '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 270,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-15',\n",
       "   'description': 'high freq. in saliva in american gut',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'saliva']],\n",
       "   'expid': 63,\n",
       "   'id': 270,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 15,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in saliva in american gut (highfreq  homo sapiens, saliva,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 271,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'sichuan province']],\n",
       "   'expid': 64,\n",
       "   'id': 271,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 153,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, sichuan province,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 272,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'sichuan province']],\n",
       "   'expid': 64,\n",
       "   'id': 272,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 15,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, sichuan province,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 279,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'amsterdam']],\n",
       "   'expid': 66,\n",
       "   'id': 279,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 102,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, adult, amsterdam,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 280,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'amsterdam']],\n",
       "   'expid': 66,\n",
       "   'id': 280,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 19,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, adult, amsterdam,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 560,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-26',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'glasgow']],\n",
       "   'expid': 73,\n",
       "   'id': 560,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 150,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, adult, glasgow,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 612,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'venezuela'],\n",
       "    ['all', 'amerindian'],\n",
       "    ['all', 'hunter gatherer']],\n",
       "   'expid': 75,\n",
       "   'id': 612,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 129,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, venezuela, amerindian, hunter gatherer,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 613,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-02-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'venezuela'],\n",
       "    ['all', 'amerindian'],\n",
       "    ['all', 'hunter gatherer']],\n",
       "   'expid': 75,\n",
       "   'id': 613,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, venezuela, amerindian, hunter gatherer,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 614,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-02-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'arm'],\n",
       "    ['all', 'skin'],\n",
       "    ['all', 'venezuela'],\n",
       "    ['all', 'amerindian'],\n",
       "    ['all', 'hunter gatherer']],\n",
       "   'expid': 75,\n",
       "   'id': 614,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 191,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 641,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-03-01',\n",
       "   'description': '',\n",
       "   'details': [['high', 'male'],\n",
       "    ['low', 'female'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'tropical grassland biome'],\n",
       "    ['all', 'kenya'],\n",
       "    ['all', 'nanger granti'],\n",
       "    ['all', 'gazelle']],\n",
       "   'expid': 78,\n",
       "   'id': 641,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 304,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in male  compared to female  in feces tropical grassland biome kenya nanger granti gazelle '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 684,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-03-05',\n",
       "   'description': 'high in healthy mallards compared to influenza A positive mallars',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'influenza'],\n",
       "    ['all', 'cloaca'],\n",
       "    ['all', 'anas platyrhynchos'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'mallard']],\n",
       "   'expid': 81,\n",
       "   'id': 684,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 131,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high in healthy mallards compared to influenza A positive mallars ( high in control  compared to influenza  in cloaca anas platyrhynchos state of california mallard '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 713,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-03-07',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'bronchus'],\n",
       "    ['all', 'lung'],\n",
       "    ['all', 'trachea'],\n",
       "    ['all', 'state of michigan']],\n",
       "   'expid': 87,\n",
       "   'id': 713,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 22,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, bronchus, lung, trachea, state of michigan,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 715,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-03-07',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'bronchus'],\n",
       "    ['all', 'lung'],\n",
       "    ['all', 'trachea'],\n",
       "    ['all', 'state of michigan']],\n",
       "   'expid': 87,\n",
       "   'id': 715,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 17,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, bronchus, lung, trachea, state of michigan,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 755,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-03-29',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'periodontitis'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'brazil'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 96,\n",
       "   'id': 755,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 24,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to periodontitis  in homo sapiens mouth brazil subgingival plaque '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 758,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-03-29',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'brazil'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 96,\n",
       "   'id': 758,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 158,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, mouth, brazil, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 759,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-03-29',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'brazil'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 96,\n",
       "   'id': 759,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 22,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, mouth, brazil, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 816,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-03',\n",
       "   'description': 'higher in cheeks compared to teeth, saliva',\n",
       "   'details': [['high', 'cheek'],\n",
       "    ['low', 'saliva'],\n",
       "    ['low', 'dentition'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'atlanta']],\n",
       "   'expid': 102,\n",
       "   'id': 816,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 41,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in cheeks compared to teeth, saliva ( high in cheek  compared to saliva dentition  in homo sapiens united states of america mouth atlanta '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 819,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-04',\n",
       "   'description': '',\n",
       "   'details': [['high', 'hiv infection'],\n",
       "    ['low', 'control'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'atlanta']],\n",
       "   'expid': 102,\n",
       "   'id': 819,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 4,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in hiv infection  compared to control  in homo sapiens united states of america mouth dentition atlanta '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 824,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-04',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'periodontitis'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'atlanta']],\n",
       "   'expid': 102,\n",
       "   'id': 824,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 7,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to periodontitis  in homo sapiens united states of america mouth atlanta '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 837,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'russia'],\n",
       "    ['all', 'moscow'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 104,\n",
       "   'id': 837,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 227,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, mouth, dentition, russia, moscow, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 839,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'pulpitis'],\n",
       "    ['all', 'brazil']],\n",
       "   'expid': 105,\n",
       "   'id': 839,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 100,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, mouth, dentition, pulpitis, brazil,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 841,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-05',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'periodontitis'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'germany'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 106,\n",
       "   'id': 841,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 14,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to periodontitis  in homo sapiens mouth dentition germany subgingival plaque '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 843,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'germany'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 106,\n",
       "   'id': 843,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 167,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, mouth, dentition, germany, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 844,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-04-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'germany'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 106,\n",
       "   'id': 844,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 16,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, mouth, dentition, germany, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 881,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-07',\n",
       "   'description': '',\n",
       "   'details': [['high', 'colon'],\n",
       "    ['low', 'caecum'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'research facility'],\n",
       "    ['all', 'texas'],\n",
       "    ['all', 'coturnix coturnix'],\n",
       "    ['all', 'common quail']],\n",
       "   'expid': 108,\n",
       "   'id': 881,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 157,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in colon  compared to caecum  in united states of america research facility texas coturnix coturnix common quail '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 960,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-12',\n",
       "   'description': 'negatively correlated with bmi',\n",
       "   'details': [['high', 'body mass index'],\n",
       "    ['high', 'low bmi'],\n",
       "    ['low', 'high bmi'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 63,\n",
       "   'id': 960,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 141,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'negatively correlated with bmi ( high in body mass index low bmi  compared to high bmi  in feces homo sapiens united states of america '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 967,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-12',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'], ['all', 'homo sapiens'], ['all', 'brazil']],\n",
       "   'expid': 120,\n",
       "   'id': 967,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 208,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, brazil,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 970,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'bangladesh']],\n",
       "   'expid': 121,\n",
       "   'id': 970,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 50,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, adult, bangladesh,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 972,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-13',\n",
       "   'description': 'high in diarrhea compared to recovery period',\n",
       "   'details': [['high', 'diarrhea'],\n",
       "    ['low', 'control'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'bangladesh']],\n",
       "   'expid': 121,\n",
       "   'id': 972,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 162,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high in diarrhea compared to recovery period ( high in diarrhea  compared to control  in feces homo sapiens adult bangladesh '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 975,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-13',\n",
       "   'description': 'negatively correlated with bmi',\n",
       "   'details': [['high', 'body mass index'],\n",
       "    ['high', 'low bmi'],\n",
       "    ['low', 'high bmi'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united kingdom']],\n",
       "   'expid': 122,\n",
       "   'id': 975,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 345,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'negatively correlated with bmi ( high in body mass index low bmi  compared to high bmi  in feces homo sapiens united kingdom '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 976,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united kingdom']],\n",
       "   'expid': 122,\n",
       "   'id': 976,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 157,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united kingdom,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1033,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'south korea']],\n",
       "   'expid': 131,\n",
       "   'id': 1033,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 128,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, south korea,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1035,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 132,\n",
       "   'id': 1035,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 145,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1038,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-16',\n",
       "   'description': 'lower in healthy babies (<1yr) compared to acute respiratory illness',\n",
       "   'details': [['high', 'respiratory system disease'],\n",
       "    ['high', 'acute respiratory illness'],\n",
       "    ['low', 'control'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'nasopharynx'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'australia']],\n",
       "   'expid': 133,\n",
       "   'id': 1038,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 83,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in healthy babies (<1yr) compared to acute respiratory illness ( high in respiratory system disease acute respiratory illness  compared to control  in homo sapiens nasopharynx infant australia '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1080,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'sediment'],\n",
       "    ['all', 'brackish water'],\n",
       "    ['all', 'marine sediment'],\n",
       "    ['all', 'caspian sea'],\n",
       "    ['all', 'depth 200m'],\n",
       "    ['all', 'sample depth 12-35cm']],\n",
       "   'expid': 141,\n",
       "   'id': 1080,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 1659,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  sediment, brackish water, marine sediment, caspian sea, depth 200m, sample depth 12-35cm,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1110,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-04-24',\n",
       "   'description': '',\n",
       "   'details': [['high', 'stream'],\n",
       "    ['low', 'pond'],\n",
       "    ['all', 'larval stage'],\n",
       "    ['all', 'intestine'],\n",
       "    ['all', 'amphibian larval stage'],\n",
       "    ['all', 'germany'],\n",
       "    ['all', 'salamandra salamandra'],\n",
       "    ['all', 'fire salamander']],\n",
       "   'expid': 149,\n",
       "   'id': 1110,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 107,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in stream  compared to pond  in larval stage intestine amphibian larval stage germany salamandra salamandra fire salamander '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1113,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-04-24',\n",
       "   'description': '',\n",
       "   'details': [['all', 'stream'],\n",
       "    ['all', 'larval stage'],\n",
       "    ['all', 'intestine'],\n",
       "    ['all', 'amphibian larval stage'],\n",
       "    ['all', 'germany'],\n",
       "    ['all', 'salamandra salamandra'],\n",
       "    ['all', 'fire salamander']],\n",
       "   'expid': 149,\n",
       "   'id': 1113,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 60,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  stream, larval stage, intestine, amphibian larval stage, germany, salamandra salamandra, fire salamander,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1187,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-07-13',\n",
       "   'description': 'common in periodontal pocket in humans',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'san diego'],\n",
       "    ['all', 'subgingival plaque'],\n",
       "    ['all', 'periodontal pocket']],\n",
       "   'expid': 162,\n",
       "   'id': 1187,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 67,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in periodontal pocket in humans (common  homo sapiens, united states of america, mouth, dentition, san diego, subgingival plaque, periodontal pocket,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1188,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-07-13',\n",
       "   'description': 'high freq. in periodontal pocket in humans',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'san diego'],\n",
       "    ['all', 'subgingival plaque'],\n",
       "    ['all', 'periodontal pocket']],\n",
       "   'expid': 162,\n",
       "   'id': 1188,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in periodontal pocket in humans (highfreq  homo sapiens, united states of america, mouth, dentition, san diego, subgingival plaque, periodontal pocket,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1189,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-07-13',\n",
       "   'description': 'common in supragingival plaque in humans',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'san diego'],\n",
       "    ['all', 'supragingival plaque']],\n",
       "   'expid': 162,\n",
       "   'id': 1189,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 86,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in supragingival plaque in humans (common  homo sapiens, united states of america, mouth, dentition, san diego, supragingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1190,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-07-13',\n",
       "   'description': 'high freq. in supragingival plaque in humans',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'san diego'],\n",
       "    ['all', 'supragingival plaque']],\n",
       "   'expid': 162,\n",
       "   'id': 1190,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in supragingival plaque in humans (highfreq  homo sapiens, united states of america, mouth, dentition, san diego, supragingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1245,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-07-26',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'austria'],\n",
       "    ['all', 'graz city district']],\n",
       "   'expid': 173,\n",
       "   'id': 1245,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 129,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, austria, graz city district,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1246,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-07-26',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'austria'],\n",
       "    ['all', 'graz city district']],\n",
       "   'expid': 173,\n",
       "   'id': 1246,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 24,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, austria, graz city district,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1262,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-07-29',\n",
       "   'description': 'common in skin of hairless mice',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'research facility'],\n",
       "    ['all', 'dorsum'],\n",
       "    ['all', 'mus musculus'],\n",
       "    ['all', 'skin'],\n",
       "    ['all', 'mouse'],\n",
       "    ['all', 'skh-1 hairless mouse']],\n",
       "   'expid': 176,\n",
       "   'id': 1262,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 133,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in skin of hairless mice (common  united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1317,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-08-20',\n",
       "   'description': 'common in patients with c. diff infection before treatment',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of minnesota'],\n",
       "    ['all', 'clostridium difficile intestinal infectious disease']],\n",
       "   'expid': 185,\n",
       "   'id': 1317,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 14,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in patients with c. diff infection before treatment (common  feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1318,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-08-20',\n",
       "   'description': 'high freq. in patients with c. diff infection before treatment',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of minnesota'],\n",
       "    ['all', 'clostridium difficile intestinal infectious disease']],\n",
       "   'expid': 185,\n",
       "   'id': 1318,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 22,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in patients with c. diff infection before treatment (highfreq  feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1333,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-09-04',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'tanzania'],\n",
       "    ['all', 'hunter gatherer'],\n",
       "    ['all', 'hadza']],\n",
       "   'expid': 190,\n",
       "   'id': 1333,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 169,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, tanzania, hunter gatherer, hadza,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1337,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-09-04',\n",
       "   'description': '',\n",
       "   'details': [['high', 'dry season'],\n",
       "    ['low', 'wet season'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'tanzania'],\n",
       "    ['all', 'hunter gatherer'],\n",
       "    ['all', 'hadza']],\n",
       "   'expid': 190,\n",
       "   'id': 1337,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 311,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in dry season  compared to wet season  in feces homo sapiens tanzania hunter gatherer hadza '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1348,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-09-05',\n",
       "   'description': 'lower in nares of people working in dairy farms',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'farm'],\n",
       "    ['low', 'bos taurus'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'pair of nares']],\n",
       "   'expid': 193,\n",
       "   'id': 1348,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 29,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in nares of people working in dairy farms ( high in control  compared to farm bos taurus  in homo sapiens united states of america pair of nares '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1351,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-09-07',\n",
       "   'description': 'common in boston subway surfaces',\n",
       "   'details': [['all', 'city'],\n",
       "    ['all', 'urban biome'],\n",
       "    ['all', 'boston'],\n",
       "    ['all', 'train']],\n",
       "   'expid': 195,\n",
       "   'id': 1351,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 116,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in boston subway surfaces (common  city, urban biome, boston, train,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1364,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-09-12',\n",
       "   'description': '',\n",
       "   'details': [['high', 'india'],\n",
       "    ['low', 'finland'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'juvenile organism'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age 13']],\n",
       "   'expid': 197,\n",
       "   'id': 1364,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 189,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in india  compared to finland  in feces homo sapiens juvenile organism obsolete_juvenile stage age 13 '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1365,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-09-12',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'juvenile organism'],\n",
       "    ['all', 'india'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age 13']],\n",
       "   'expid': 197,\n",
       "   'id': 1365,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 170,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, juvenile organism, india, obsolete_juvenile stage, age 13,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1367,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-09-12',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'juvenile organism'],\n",
       "    ['all', 'finland'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age 13']],\n",
       "   'expid': 197,\n",
       "   'id': 1367,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 136,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, age 13,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1375,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': 'common on shower wall tile',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'building'],\n",
       "    ['all', 'urban biome'],\n",
       "    ['all', 'bathroom'],\n",
       "    ['all', 'shower'],\n",
       "    ['all', 'tile'],\n",
       "    ['all', 'wall']],\n",
       "   'expid': 199,\n",
       "   'id': 1375,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 90,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common on shower wall tile (common  united states of america, building, urban biome, bathroom, shower, tile, wall,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1377,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': 'common in kitchen sink',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'building'],\n",
       "    ['all', 'urban biome'],\n",
       "    ['all', 'kitchen'],\n",
       "    ['all', 'sink']],\n",
       "   'expid': 199,\n",
       "   'id': 1377,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 130,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in kitchen sink (common  united states of america, building, urban biome, kitchen, sink,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1385,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': 'common in decaying Saguaro cactus',\n",
       "   'details': [['all', 'desert'],\n",
       "    ['all', 'mexico'],\n",
       "    ['all', 'cactus'],\n",
       "    ['all', 'carnegiea gigantea'],\n",
       "    ['all', 'saguaro'],\n",
       "    ['all', 'decaying']],\n",
       "   'expid': 201,\n",
       "   'id': 1385,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 193,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in decaying Saguaro cactus (common  desert, mexico, cactus, carnegiea gigantea, saguaro, decaying,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1387,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': 'common in decaying Cardon cactus',\n",
       "   'details': [['all', 'desert'],\n",
       "    ['all', 'mexico'],\n",
       "    ['all', 'cactus'],\n",
       "    ['all', 'decaying'],\n",
       "    ['all', 'pachycereus pringlei'],\n",
       "    ['all', 'cardon']],\n",
       "   'expid': 201,\n",
       "   'id': 1387,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 193,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in decaying Cardon cactus (common  desert, mexico, cactus, decaying, pachycereus pringlei, cardon,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1391,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'mouth mucosa']],\n",
       "   'expid': 202,\n",
       "   'id': 1391,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 100,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, china, mouth, oral cavity, mouth mucosa,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1392,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-10-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'mouth mucosa']],\n",
       "   'expid': 202,\n",
       "   'id': 1392,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 24,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, china, mouth, oral cavity, mouth mucosa,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1395,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'australia'],\n",
       "    ['all', 'obsolete_juvenile stage']],\n",
       "   'expid': 203,\n",
       "   'id': 1395,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 81,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, mouth, oral cavity, dentition, australia, obsolete_juvenile stage,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1396,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-10-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'australia'],\n",
       "    ['all', 'obsolete_juvenile stage']],\n",
       "   'expid': 203,\n",
       "   'id': 1396,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, mouth, oral cavity, dentition, australia, obsolete_juvenile stage,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1423,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-10-05',\n",
       "   'description': 'high freq. in people hospitalized with diarrhea',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'diarrhea'],\n",
       "    ['all', 'israel']],\n",
       "   'expid': 207,\n",
       "   'id': 1423,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 18,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in people hospitalized with diarrhea (highfreq  feces, homo sapiens, diarrhea, israel,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1431,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-15',\n",
       "   'description': 'common in whale blow condensate',\n",
       "   'details': [['all', 'respiratory airway'],\n",
       "    ['all', 'north america'],\n",
       "    ['all', 'megaptera novaeangliae'],\n",
       "    ['all', 'humpback whale'],\n",
       "    ['all', 'exhaled air condensate'],\n",
       "    ['all', 'whale blow']],\n",
       "   'expid': 209,\n",
       "   'id': 1431,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 161,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in whale blow condensate (common  respiratory airway, north america, megaptera novaeangliae, humpback whale, exhaled air condensate, whale blow,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1435,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-10-15',\n",
       "   'description': 'higher in whale blow condensate compared to ocean water',\n",
       "   'details': [['high', 'respiratory airway'],\n",
       "    ['high', 'megaptera novaeangliae'],\n",
       "    ['high', 'humpback whale'],\n",
       "    ['high', 'exhaled air condensate'],\n",
       "    ['high', 'whale blow'],\n",
       "    ['low', 'ocean'],\n",
       "    ['low', 'sea water'],\n",
       "    ['low', 'depth 25cm'],\n",
       "    ['all', 'north america']],\n",
       "   'expid': 209,\n",
       "   'id': 1435,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 359,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow  compared to ocean sea water depth 25cm  in north america '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1472,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 215,\n",
       "   'id': 1472,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 107,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1549,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-10-31',\n",
       "   'description': 'lower in chronic sinositis compared to healthy controls in sinus brushing',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'sinusitis'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mucosa'],\n",
       "    ['all', 'paranasal sinus'],\n",
       "    ['all', 'sinusoidal space']],\n",
       "   'expid': 228,\n",
       "   'id': 1549,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 60,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in chronic sinositis compared to healthy controls in sinus brushing ( high in control  compared to sinusitis  in homo sapiens united states of america mucosa paranasal sinus sinusoidal space '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1551,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-10-31',\n",
       "   'description': 'common in sinus brush of healthy participants',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mucosa'],\n",
       "    ['all', 'paranasal sinus'],\n",
       "    ['all', 'sinusoidal space']],\n",
       "   'expid': 228,\n",
       "   'id': 1551,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 36,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in sinus brush of healthy participants (common  homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1552,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-10-31',\n",
       "   'description': 'high freq. in sinus brush of healthy participants',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mucosa'],\n",
       "    ['all', 'paranasal sinus'],\n",
       "    ['all', 'sinusoidal space']],\n",
       "   'expid': 228,\n",
       "   'id': 1552,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 11,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in sinus brush of healthy participants (highfreq  homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1576,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-05',\n",
       "   'description': 'lower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'ulcer'],\n",
       "    ['low', 'wound'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'diabetes mellitus'],\n",
       "    ['all', 'skin'],\n",
       "    ['all', 'foot'],\n",
       "    ['all', 'australia']],\n",
       "   'expid': 232,\n",
       "   'id': 1576,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 836,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control  compared to ulcer wound  in homo sapiens diabetes mellitus skin foot australia '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1579,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-05',\n",
       "   'description': 'coomon in foot of healthy controls',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'skin'],\n",
       "    ['all', 'foot'],\n",
       "    ['all', 'australia']],\n",
       "   'expid': 232,\n",
       "   'id': 1579,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 166,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'coomon in foot of healthy controls (common  homo sapiens, skin, foot, australia,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1622,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-07',\n",
       "   'description': 'lower in burrow soil compared to bird',\n",
       "   'details': [['high', 'bird'],\n",
       "    ['high', 'oceanodroma leucorhoa'],\n",
       "    ['high', 'seabird'],\n",
       "    ['low', 'soil'],\n",
       "    ['low', 'burrow'],\n",
       "    ['all', 'canada'],\n",
       "    ['all', 'bon portage island']],\n",
       "   'expid': 237,\n",
       "   'id': 1622,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 298,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird  compared to soil burrow  in canada bon portage island '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1623,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-07',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'], ['all', 'homo sapiens'], ['all', 'colombia']],\n",
       "   'expid': 238,\n",
       "   'id': 1623,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 96,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, colombia,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1627,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-08',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 239,\n",
       "   'id': 1627,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 117,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1630,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-12',\n",
       "   'description': 'lower in infants age<1 year compared to 1-3 years in baby feces',\n",
       "   'details': [['high', 'age'],\n",
       "    ['high', 'age > 1 year'],\n",
       "    ['low', 'age <1 year'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'finland']],\n",
       "   'expid': 240,\n",
       "   'id': 1630,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 567,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year  compared to age <1 year  in feces homo sapiens infant finland '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1631,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-12',\n",
       "   'description': 'common in infants age <3 years',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'finland'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 240,\n",
       "   'id': 1631,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 36,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in infants age <3 years (common  feces, homo sapiens, infant, finland, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1634,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'lower in babies from russia compared to finland',\n",
       "   'details': [['high', 'finland'],\n",
       "    ['low', 'russia'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1634,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 148,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in babies from russia compared to finland ( high in finland  compared to russia  in feces homo sapiens infant age < 3 years '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1636,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'lower in babies from russia compared to estonia',\n",
       "   'details': [['high', 'estonia'],\n",
       "    ['low', 'russia'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1636,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 169,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'lower in babies from russia compared to estonia ( high in estonia  compared to russia  in feces homo sapiens infant age < 3 years '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1639,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'higher in babies age <1 year compared to age 1-3 years',\n",
       "   'details': [['high', 'age'],\n",
       "    ['high', 'age < 1 year'],\n",
       "    ['low', 'age 1-3 years'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant']],\n",
       "   'expid': 241,\n",
       "   'id': 1639,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 13,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in babies age <1 year compared to age 1-3 years ( high in age age < 1 year  compared to age 1-3 years  in feces homo sapiens infant '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1641,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'common in babies age < 3 years in russia',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'russia'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1641,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 44,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in babies age < 3 years in russia (common  feces, homo sapiens, infant, russia, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1643,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'common in babies age < 3 years in finland',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'finland'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1643,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 23,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in babies age < 3 years in finland (common  feces, homo sapiens, infant, finland, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1644,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'high freq. in babies age < 3 years in finland',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'finland'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1644,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 21,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in babies age < 3 years in finland (highfreq  feces, homo sapiens, infant, finland, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1645,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'common in babies age < 3 years in estonia',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'estonia'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1645,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 24,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in babies age < 3 years in estonia (common  feces, homo sapiens, infant, estonia, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1646,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-11-13',\n",
       "   'description': 'high freq. in babies age < 3 years in estonia',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'estonia'],\n",
       "    ['all', 'age < 3 years']],\n",
       "   'expid': 241,\n",
       "   'id': 1646,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 23,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in babies age < 3 years in estonia (highfreq  feces, homo sapiens, infant, estonia, age < 3 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1648,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-14',\n",
       "   'description': 'higher in native-americans compared to non native-american',\n",
       "   'details': [['high', 'cheyenne'],\n",
       "    ['high', 'native american'],\n",
       "    ['high', 'arapaho'],\n",
       "    ['low', 'american'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of oklahoma']],\n",
       "   'expid': 242,\n",
       "   'id': 1648,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 23,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in native-americans compared to non native-american ( high in cheyenne native american arapaho  compared to american  in feces homo sapiens united states of america state of oklahoma '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1667,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-21',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'obesity'],\n",
       "    ['low', 'body mass index'],\n",
       "    ['low', 'high bmi'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'italy']],\n",
       "   'expid': 246,\n",
       "   'id': 1667,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 46,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to obesity body mass index high bmi  in homo sapiens saliva italy '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1668,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-21',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'saliva'], ['all', 'italy']],\n",
       "   'expid': 246,\n",
       "   'id': 1668,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 133,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, saliva, italy,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1669,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-11-21',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'], ['all', 'saliva'], ['all', 'italy']],\n",
       "   'expid': 246,\n",
       "   'id': 1669,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 18,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, saliva, italy,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1687,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-11-22',\n",
       "   'description': 'common in clouds in puy de dome mountain in france',\n",
       "   'details': [['all', 'air'],\n",
       "    ['all', 'french republic'],\n",
       "    ['all', 'fall'],\n",
       "    ['all', 'cloud']],\n",
       "   'expid': 253,\n",
       "   'id': 1687,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 267,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in clouds in puy de dome mountain in france (common  air, french republic, fall, cloud,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1706,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-11-26',\n",
       "   'description': 'higher in small intestine compared to colon in pigs',\n",
       "   'details': [['high', 'duodenum'],\n",
       "    ['high', 'jejunum'],\n",
       "    ['high', 'ileum'],\n",
       "    ['low', 'caecum'],\n",
       "    ['low', 'left colon'],\n",
       "    ['low', 'right colon'],\n",
       "    ['all', 'sus scrofa'],\n",
       "    ['all', 'united kingdom'],\n",
       "    ['all', 'pig']],\n",
       "   'expid': 256,\n",
       "   'id': 1706,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 387,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum  compared to caecum left colon right colon  in sus scrofa united kingdom pig '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1726,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-12-04',\n",
       "   'description': 'higher in individuals with high physical activity',\n",
       "   'details': [['high', 'physical activity'],\n",
       "    ['low', 'little physical activity'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 63,\n",
       "   'id': 1726,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 140,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in individuals with high physical activity ( high in physical activity  compared to little physical activity  in feces homo sapiens united states of america '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1727,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2017-12-04',\n",
       "   'description': '',\n",
       "   'details': [['high', 'male'],\n",
       "    ['low', 'female'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america']],\n",
       "   'expid': 63,\n",
       "   'id': 1727,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 262,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in male  compared to female  in feces homo sapiens united states of america '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1729,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2017-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'state of nebraska'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 260,\n",
       "   'id': 1729,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 59,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, mouth, dentition, state of nebraska, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1730,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2017-12-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'state of nebraska'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 260,\n",
       "   'id': 1730,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 24,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, united states of america, mouth, dentition, state of nebraska, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1803,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-10',\n",
       "   'description': 'common in subgingival plaque in south korea',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'south korea'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 272,\n",
       "   'id': 1803,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 65,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in subgingival plaque in south korea (common  homo sapiens, mouth, dentition, south korea, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1804,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-01-10',\n",
       "   'description': 'high freq. in subgingival plaque in south korea',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'dentition'],\n",
       "    ['all', 'south korea'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 272,\n",
       "   'id': 1804,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 18,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in subgingival plaque in south korea (highfreq  homo sapiens, mouth, dentition, south korea, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1805,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['high', 'age'],\n",
       "    ['high', 'age 1 week'],\n",
       "    ['low', 'age one month'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark']],\n",
       "   'expid': 273,\n",
       "   'id': 1805,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 127,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in age age 1 week  compared to age one month  in feces homo sapiens infant kingdom of denmark '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1807,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['high', 'age'],\n",
       "    ['high', 'age one year'],\n",
       "    ['low', 'age one month'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark']],\n",
       "   'expid': 273,\n",
       "   'id': 1807,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 557,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in age age one year  compared to age one month  in feces homo sapiens infant kingdom of denmark '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1809,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark'],\n",
       "    ['all', 'age one week']],\n",
       "   'expid': 273,\n",
       "   'id': 1809,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, infant, kingdom of denmark, age one week,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1810,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark'],\n",
       "    ['all', 'age one week']],\n",
       "   'expid': 273,\n",
       "   'id': 1810,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  feces, homo sapiens, infant, kingdom of denmark, age one week,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1811,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark'],\n",
       "    ['all', 'age one month']],\n",
       "   'expid': 273,\n",
       "   'id': 1811,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 16,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, infant, kingdom of denmark, age one month,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1813,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark'],\n",
       "    ['all', 'age one year']],\n",
       "   'expid': 273,\n",
       "   'id': 1813,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 46,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, infant, kingdom of denmark, age one year,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1814,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-01-14',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of denmark'],\n",
       "    ['all', 'age one year']],\n",
       "   'expid': 273,\n",
       "   'id': 1814,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  feces, homo sapiens, infant, kingdom of denmark, age one year,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1827,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-22',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'peru'],\n",
       "    ['all', 'small village'],\n",
       "    ['all', 'tunapuco'],\n",
       "    ['all', 'rural community']],\n",
       "   'expid': 276,\n",
       "   'id': 1827,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 263,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, adult, peru, small village, tunapuco, rural community,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1829,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-22',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'city'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of oklahoma']],\n",
       "   'expid': 276,\n",
       "   'id': 1829,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 110,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america, city, adult, state of oklahoma,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1833,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'nasal cavity'],\n",
       "    ['all', 'pair of nares'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'belgium']],\n",
       "   'expid': 277,\n",
       "   'id': 1833,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 37,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, nasal cavity, pair of nares, adult, belgium,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1834,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'nasal cavity'],\n",
       "    ['all', 'pair of nares'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'belgium']],\n",
       "   'expid': 277,\n",
       "   'id': 1834,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 14,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, nasal cavity, pair of nares, adult, belgium,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1835,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'nasopharynx'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'belgium']],\n",
       "   'expid': 277,\n",
       "   'id': 1835,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, nasopharynx, adult, belgium,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1837,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'subgingival plaque']],\n",
       "   'expid': 278,\n",
       "   'id': 1837,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 96,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, adult, state of california, subgingival plaque,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1839,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of california']],\n",
       "   'expid': 278,\n",
       "   'id': 1839,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 133,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, saliva, adult, state of california,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1840,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of california']],\n",
       "   'expid': 278,\n",
       "   'id': 1840,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 17,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, united states of america, saliva, adult, state of california,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1841,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-01-23',\n",
       "   'description': '',\n",
       "   'details': [['high', 'saliva'],\n",
       "    ['low', 'subgingival plaque'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of california']],\n",
       "   'expid': 278,\n",
       "   'id': 1841,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 146,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in saliva  compared to subgingival plaque  in homo sapiens united states of america adult state of california '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1879,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of california']],\n",
       "   'expid': 284,\n",
       "   'id': 1879,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 105,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, female, adult, state of california,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1881,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'age 2 months']],\n",
       "   'expid': 284,\n",
       "   'id': 1881,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, female, infant, state of california, age 2 months,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1883,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'age 6 months']],\n",
       "   'expid': 284,\n",
       "   'id': 1883,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 25,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, female, infant, state of california, age 6 months,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1885,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'female'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'age 1 year']],\n",
       "   'expid': 284,\n",
       "   'id': 1885,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 30,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, female, infant, state of california, age 1 year,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1894,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': 'common in feces of individuals without kidney stones',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'nanning city prefecture'],\n",
       "    ['all', 'age 50-60 years']],\n",
       "   'expid': 286,\n",
       "   'id': 1894,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 281,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in feces of individuals without kidney stones (common  feces, homo sapiens, control, china, adult, nanning city prefecture, age 50-60 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1896,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-01-27',\n",
       "   'description': 'common in feces of individuals with kidney stones',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'nephrolithiasis'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'nanning city prefecture'],\n",
       "    ['all', 'age 50-60 years']],\n",
       "   'expid': 286,\n",
       "   'id': 1896,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 239,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in feces of individuals with kidney stones (common  feces, homo sapiens, china, nephrolithiasis, adult, nanning city prefecture, age 50-60 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1910,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'state of michigan']],\n",
       "   'expid': 289,\n",
       "   'id': 1910,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 109,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america, adult, state of michigan,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1914,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'small village'],\n",
       "    ['all', 'rural community']],\n",
       "   'expid': 290,\n",
       "   'id': 1914,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 218,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, china, adult, small village, rural community,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1916,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-01',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'city'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 290,\n",
       "   'id': 1916,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 162,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, china, city, adult,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1922,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 292,\n",
       "   'id': 1922,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 81,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, control, china, adult,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1923,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'ulcerative colitis'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 292,\n",
       "   'id': 1923,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 53,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, china, ulcerative colitis, adult,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1924,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-05',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', \"crohn's disease\"],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 292,\n",
       "   'id': 1924,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 55,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  \"common  feces, homo sapiens, china, crohn's disease, adult,\"),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1929,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-02-07',\n",
       "   'description': 'higher in caloric restriction (CRON) diet compared to american diet',\n",
       "   'details': [['high', 'diet'],\n",
       "    ['high', 'cron diet'],\n",
       "    ['high', 'caloric restriction diet'],\n",
       "    ['low', 'american diet'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 293,\n",
       "   'id': 1929,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 381,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet  compared to american diet  in feces homo sapiens united states of america adult '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1938,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-09',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'irritable bowel syndrome'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'kingdom of spain']],\n",
       "   'expid': 294,\n",
       "   'id': 1938,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 120,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, irritable bowel syndrome, adult, kingdom of spain,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1940,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-09',\n",
       "   'description': 'common in non-IBS healthy controls',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'kingdom of spain']],\n",
       "   'expid': 294,\n",
       "   'id': 1940,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 137,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in non-IBS healthy controls (common  feces, homo sapiens, control, adult, kingdom of spain,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1957,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-02-12',\n",
       "   'description': '',\n",
       "   'details': [['high', \"crohn's disease\"],\n",
       "    ['high', 'ulcerative colitis'],\n",
       "    ['low', 'control'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'child'],\n",
       "    ['all', 'atlanta'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age<17 years']],\n",
       "   'expid': 297,\n",
       "   'id': 1957,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 22,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  \" high in crohn's disease ulcerative colitis  compared to control  in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years \"),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1958,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-12',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'child'],\n",
       "    ['all', 'atlanta'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age<17 years']],\n",
       "   'expid': 297,\n",
       "   'id': 1958,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 162,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1959,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-02-12',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'child'],\n",
       "    ['all', 'atlanta'],\n",
       "    ['all', 'obsolete_juvenile stage'],\n",
       "    ['all', 'age<17 years']],\n",
       "   'expid': 297,\n",
       "   'id': 1959,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 22,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1966,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'cancer'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'mouth neoplasm']],\n",
       "   'expid': 299,\n",
       "   'id': 1966,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 188,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, china, saliva, cancer, adult, mouth neoplasm,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1967,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-02-27',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'cancer'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'mouth neoplasm']],\n",
       "   'expid': 299,\n",
       "   'id': 1967,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 19,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, china, saliva, cancer, adult, mouth neoplasm,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1968,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-02-27',\n",
       "   'description': 'common in healthy (non-tumor) controls',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 299,\n",
       "   'id': 1968,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 179,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in healthy (non-tumor) controls (common  homo sapiens, control, china, saliva, adult,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1969,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-02-27',\n",
       "   'description': 'high freq. in healthy (non-tumor) controls',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 299,\n",
       "   'id': 1969,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 20,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in healthy (non-tumor) controls (highfreq  homo sapiens, control, china, saliva, adult,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 1970,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-02-27',\n",
       "   'description': '',\n",
       "   'details': [['high', 'control'],\n",
       "    ['low', 'cancer'],\n",
       "    ['low', 'mouth neoplasm'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 299,\n",
       "   'id': 1970,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 75,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in control  compared to cancer mouth neoplasm  in homo sapiens china saliva adult '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2055,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-03-31',\n",
       "   'description': 'common in neonatal intensive care unit floor',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'dust'],\n",
       "    ['all', 'hospital'],\n",
       "    ['all', 'state of california'],\n",
       "    ['all', 'floor']],\n",
       "   'expid': 308,\n",
       "   'id': 2055,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 57,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in neonatal intensive care unit floor (common  united states of america, dust, hospital, state of california, floor,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2126,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-09',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'spondylitis'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'french republic'],\n",
       "    ['all', 'spondyloarthritis']],\n",
       "   'expid': 312,\n",
       "   'id': 2126,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 197,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, spondylitis, adult, french republic, spondyloarthritis,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2171,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of texas']],\n",
       "   'expid': 319,\n",
       "   'id': 2171,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 183,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, united states of america, state of texas,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2173,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'state of texas']],\n",
       "   'expid': 319,\n",
       "   'id': 2173,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 87,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, saliva, state of texas,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2174,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-04-18',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'saliva'],\n",
       "    ['all', 'state of texas']],\n",
       "   'expid': 319,\n",
       "   'id': 2174,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 16,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, united states of america, saliva, state of texas,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2177,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-19',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', \"crohn's disease\"],\n",
       "    ['all', 'adult']],\n",
       "   'expid': 320,\n",
       "   'id': 2177,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 30,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  \"common  feces, homo sapiens, crohn's disease, adult,\"),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2195,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-24',\n",
       "   'description': 'common in shark cloaca',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'anal canal'],\n",
       "    ['all', 'atlantic ocean'],\n",
       "    ['all', 'state of florida'],\n",
       "    ['all', 'south florida'],\n",
       "    ['all', 'shark']],\n",
       "   'expid': 323,\n",
       "   'id': 2195,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 167,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in shark cloaca (common  united states of america, anal canal, atlantic ocean, state of florida, south florida, shark,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2199,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-24',\n",
       "   'description': 'common in shark skin',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'skin'],\n",
       "    ['all', 'atlantic ocean'],\n",
       "    ['all', 'state of florida'],\n",
       "    ['all', 'south florida'],\n",
       "    ['all', 'shark']],\n",
       "   'expid': 323,\n",
       "   'id': 2199,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 213,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in shark skin (common  united states of america, skin, atlantic ocean, state of florida, south florida, shark,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2201,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-04-24',\n",
       "   'description': 'common in shark gills',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'gill'],\n",
       "    ['all', 'atlantic ocean'],\n",
       "    ['all', 'state of florida'],\n",
       "    ['all', 'south florida'],\n",
       "    ['all', 'shark']],\n",
       "   'expid': 323,\n",
       "   'id': 2201,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 170,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in shark gills (common  united states of america, gill, atlantic ocean, state of florida, south florida, shark,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2206,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-04-24',\n",
       "   'description': 'higher in sharks compared to sea water',\n",
       "   'details': [['high', 'shark'],\n",
       "    ['low', 'water'],\n",
       "    ['low', 'surface water'],\n",
       "    ['low', 'ocean water'],\n",
       "    ['low', 'depth 0m'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'atlantic ocean'],\n",
       "    ['all', 'state of florida'],\n",
       "    ['all', 'south florida']],\n",
       "   'expid': 323,\n",
       "   'id': 2206,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 107,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in sharks compared to sea water ( high in shark  compared to water surface water ocean water depth 0m  in united states of america atlantic ocean state of florida south florida '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2235,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-05-13',\n",
       "   'description': '',\n",
       "   'details': [['high', 'infant'],\n",
       "    ['high', 'age 1 year'],\n",
       "    ['low', 'adult'],\n",
       "    ['low', 'age 30-40'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'kingdom of norway'],\n",
       "    ['all', 'oslo']],\n",
       "   'expid': 330,\n",
       "   'id': 2235,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 19,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in infant age 1 year  compared to adult age 30-40  in feces homo sapiens kingdom of norway oslo '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2239,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-13',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'infant'],\n",
       "    ['all', 'kingdom of norway'],\n",
       "    ['all', 'oslo'],\n",
       "    ['all', 'age 1 year']],\n",
       "   'expid': 330,\n",
       "   'id': 2239,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 39,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, infant, kingdom of norway, oslo, age 1 year,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2241,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-05-13',\n",
       "   'description': '',\n",
       "   'details': [['high', 'dry season'],\n",
       "    ['low', 'wet season'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'ethiopia'],\n",
       "    ['all', 'monkey'],\n",
       "    ['all', 'theropithecus gelada']],\n",
       "   'expid': 331,\n",
       "   'id': 2241,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 232,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  ' high in dry season  compared to wet season  in feces ethiopia monkey theropithecus gelada '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2250,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-15',\n",
       "   'description': 'common in healthy controls feces',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'control'],\n",
       "    ['all', 'china'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'guangzhou city prefecture']],\n",
       "   'expid': 333,\n",
       "   'id': 2250,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 61,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in healthy controls feces (common  feces, homo sapiens, control, china, adult, guangzhou city prefecture,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2260,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'bronchial epithelium']],\n",
       "   'expid': 335,\n",
       "   'id': 2260,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 61,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  homo sapiens, united states of america, bronchial epithelium,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2261,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-05-16',\n",
       "   'description': '',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'bronchial epithelium']],\n",
       "   'expid': 335,\n",
       "   'id': 2261,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 15,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'highfreq  homo sapiens, united states of america, bronchial epithelium,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2263,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-16',\n",
       "   'description': 'common in mouthwash',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'oral wash']],\n",
       "   'expid': 335,\n",
       "   'id': 2263,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 52,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in mouthwash (common  homo sapiens, united states of america, mouth, oral cavity, oral wash,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2264,\n",
       "   'annotationtype': 'highfreq',\n",
       "   'date': '2018-05-16',\n",
       "   'description': 'high freq. in mouthwash',\n",
       "   'details': [['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'mouth'],\n",
       "    ['all', 'oral cavity'],\n",
       "    ['all', 'oral wash']],\n",
       "   'expid': 335,\n",
       "   'id': 2264,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 12,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'high freq. in mouthwash (highfreq  homo sapiens, united states of america, mouth, oral cavity, oral wash,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2277,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-24',\n",
       "   'description': '',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'adult'],\n",
       "    ['all', 'india']],\n",
       "   'expid': 339,\n",
       "   'id': 2277,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 81,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common  feces, homo sapiens, adult, india,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2301,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-28',\n",
       "   'description': 'common in apple flowers',\n",
       "   'details': [['all', 'united states of america'],\n",
       "    ['all', 'flower structure'],\n",
       "    ['all', 'malus x domestica'],\n",
       "    ['all', 'state of connecticut'],\n",
       "    ['all', 'flower'],\n",
       "    ['all', 'apple']],\n",
       "   'expid': 343,\n",
       "   'id': 2301,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 118,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in apple flowers (common  united states of america, flower structure, malus x domestica, state of connecticut, flower, apple,'),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2303,\n",
       "   'annotationtype': 'diffexp',\n",
       "   'date': '2018-05-31',\n",
       "   'description': 'higher in gay (msm) individuals compared to heterosexual (msw)',\n",
       "   'details': [['high', 'gay'],\n",
       "    ['high', 'homosexual'],\n",
       "    ['high', 'msm'],\n",
       "    ['low', 'heterosexual'],\n",
       "    ['low', 'msw'],\n",
       "    ['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of colorado'],\n",
       "    ['all', 'denver']],\n",
       "   'expid': 344,\n",
       "   'id': 2303,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 124,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'higher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm  compared to heterosexual msw  in feces homo sapiens united states of america state of colorado denver '),\n",
       " ({'agent': 'calour',\n",
       "   'annotationid': 2309,\n",
       "   'annotationtype': 'common',\n",
       "   'date': '2018-05-31',\n",
       "   'description': 'common in feces of homosexual males',\n",
       "   'details': [['all', 'feces'],\n",
       "    ['all', 'homo sapiens'],\n",
       "    ['all', 'united states of america'],\n",
       "    ['all', 'state of colorado'],\n",
       "    ['all', 'denver'],\n",
       "    ['all', 'gay'],\n",
       "    ['all', 'homosexual'],\n",
       "    ['all', 'msm']],\n",
       "   'expid': 344,\n",
       "   'id': 2309,\n",
       "   'method': 'na',\n",
       "   'num_sequences': 87,\n",
       "   'private': 'n',\n",
       "   'userid': 1,\n",
       "   'username': 'amnon'},\n",
       "  'common in feces of homosexual males (common  feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm,')]"
      ]
     },
     "execution_count": 10,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "c"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {
    "collapsed": true,
    "jupyter": {
     "outputs_hidden": true
    }
   },
   "outputs": [],
   "source": [
    "import calour as ca"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [],
   "source": [
    "dat=ca.read_amplicon('/Users/amnon/Projects/antlion/all.biom',normalize=10000,min_reads=1000)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {
    "collapsed": true,
    "jupyter": {
     "outputs_hidden": true
    }
   },
   "outputs": [],
   "source": [
    "datc=dat.cluster_features(10)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [],
   "source": [
    "res=a.enrichment(datc,datc.feature_metadata.index.values[:50],alpha=1)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "(                                      odif     pvals  \\\n",
       " **266**state of idaho            -9.332143  0.028971   \n",
       " **266**boechera stricta          -8.078571  0.044955   \n",
       " **266**brassicaceae              -8.078571  0.044955   \n",
       " **232**-ulcer                    -7.800000  0.113886   \n",
       " **232**-wound                    -7.800000  0.113886   \n",
       " **311**scallion                  -7.465714  0.047952   \n",
       " plant                            -6.964286  0.104895   \n",
       " bronchoalveolar lavage           -6.518571  0.088911   \n",
       " **201**-decaying                 -6.462857  0.120879   \n",
       " -cactus                          -6.462857  0.120879   \n",
       " food product                     -6.267857  0.193806   \n",
       " **304**aerosol                   -6.240000  0.038961   \n",
       " **311**state of rhode island     -5.877857  0.210789   \n",
       " **40**nicotiana tabacum          -5.794286  0.193806   \n",
       " **40**field soil                 -5.794286  0.193806   \n",
       " solanum lycopersicum             -5.710714  0.138861   \n",
       " river                            -5.460000  0.249750   \n",
       " **311**garlic                    -5.404286  0.086913   \n",
       " **269**-food spoilage            -5.070000  0.212787   \n",
       " **53**influent                   -5.014286  0.321678   \n",
       " -effluent                        -5.014286  0.321678   \n",
       " **53**sewage                     -5.014286  0.321678   \n",
       " **252**rock                      -4.902857  0.219780   \n",
       " **252**epilithic                 -4.902857  0.219780   \n",
       " **201**drosophila                -4.847143  0.207792   \n",
       " **201**fly                       -4.847143  0.207792   \n",
       " **201**drosophila nigrospiracula -4.847143  0.207792   \n",
       " **304**monterey bay              -4.791429  0.059940   \n",
       " small intestine                  -4.763571  0.217782   \n",
       " **175**heavy metal               -4.707857  0.112887   \n",
       " ...                                    ...       ...   \n",
       " -ocean                            3.955714  0.408591   \n",
       " age                               3.983571  0.379620   \n",
       " cancer                            3.983571  0.239760   \n",
       " mouth neoplasm                    3.983571  0.239760   \n",
       " megaptera novaeangliae            4.011429  0.327672   \n",
       " humpback whale                    4.011429  0.327672   \n",
       " high temperature habitat          4.039286  0.231768   \n",
       " hawaii                            4.039286  0.184815   \n",
       " **267**cadmium                    4.067143  0.235764   \n",
       " **209**exhaled air condensate     4.122857  0.319680   \n",
       " **209**whale blow                 4.122857  0.319680   \n",
       " **209**respiratory airway         4.122857  0.319680   \n",
       " oral cavity                       4.150714  0.182817   \n",
       " **108**nile tilapia               4.234286  0.152847   \n",
       " kingdom of the netherlands        4.457143  0.290709   \n",
       " control                           4.485000  0.383616   \n",
       " nasopharynx                       4.512857  0.325674   \n",
       " -periodontitis                    4.512857  0.155844   \n",
       " **48**hypopharynx                 4.652143  0.247752   \n",
       " united kingdom                    4.819286  0.331668   \n",
       " body mass index                   4.902857  0.125874   \n",
       " pregnancy                         4.902857  0.246753   \n",
       " state of tennessee                5.070000  0.264735   \n",
       " **81**mallard                     5.460000  0.070929   \n",
       " **81**anas platyrhynchos          5.460000  0.070929   \n",
       " texas                             5.655000  0.100899   \n",
       " kingdom of denmark                6.100714  0.190809   \n",
       " subgingival plaque                6.267857  0.069930   \n",
       " saliva                            6.323571  0.063936   \n",
       " oreochromis niloticus             7.716429  0.032967   \n",
       " \n",
       "                                                               term  \n",
       " **266**state of idaho                        **266**state of idaho  \n",
       " **266**boechera stricta                    **266**boechera stricta  \n",
       " **266**brassicaceae                            **266**brassicaceae  \n",
       " **232**-ulcer                                        **232**-ulcer  \n",
       " **232**-wound                                        **232**-wound  \n",
       " **311**scallion                                    **311**scallion  \n",
       " plant                                                        plant  \n",
       " bronchoalveolar lavage                      bronchoalveolar lavage  \n",
       " **201**-decaying                                  **201**-decaying  \n",
       " -cactus                                                    -cactus  \n",
       " food product                                          food product  \n",
       " **304**aerosol                                      **304**aerosol  \n",
       " **311**state of rhode island          **311**state of rhode island  \n",
       " **40**nicotiana tabacum                    **40**nicotiana tabacum  \n",
       " **40**field soil                                  **40**field soil  \n",
       " solanum lycopersicum                          solanum lycopersicum  \n",
       " river                                                        river  \n",
       " **311**garlic                                        **311**garlic  \n",
       " **269**-food spoilage                        **269**-food spoilage  \n",
       " **53**influent                                      **53**influent  \n",
       " -effluent                                                -effluent  \n",
       " **53**sewage                                          **53**sewage  \n",
       " **252**rock                                            **252**rock  \n",
       " **252**epilithic                                  **252**epilithic  \n",
       " **201**drosophila                                **201**drosophila  \n",
       " **201**fly                                              **201**fly  \n",
       " **201**drosophila nigrospiracula  **201**drosophila nigrospiracula  \n",
       " **304**monterey bay                            **304**monterey bay  \n",
       " small intestine                                    small intestine  \n",
       " **175**heavy metal                              **175**heavy metal  \n",
       " ...                                                            ...  \n",
       " -ocean                                                      -ocean  \n",
       " age                                                            age  \n",
       " cancer                                                      cancer  \n",
       " mouth neoplasm                                      mouth neoplasm  \n",
       " megaptera novaeangliae                      megaptera novaeangliae  \n",
       " humpback whale                                      humpback whale  \n",
       " high temperature habitat                  high temperature habitat  \n",
       " hawaii                                                      hawaii  \n",
       " **267**cadmium                                      **267**cadmium  \n",
       " **209**exhaled air condensate        **209**exhaled air condensate  \n",
       " **209**whale blow                                **209**whale blow  \n",
       " **209**respiratory airway                **209**respiratory airway  \n",
       " oral cavity                                            oral cavity  \n",
       " **108**nile tilapia                            **108**nile tilapia  \n",
       " kingdom of the netherlands              kingdom of the netherlands  \n",
       " control                                                    control  \n",
       " nasopharynx                                            nasopharynx  \n",
       " -periodontitis                                      -periodontitis  \n",
       " **48**hypopharynx                                **48**hypopharynx  \n",
       " united kingdom                                      united kingdom  \n",
       " body mass index                                    body mass index  \n",
       " pregnancy                                                pregnancy  \n",
       " state of tennessee                              state of tennessee  \n",
       " **81**mallard                                        **81**mallard  \n",
       " **81**anas platyrhynchos                  **81**anas platyrhynchos  \n",
       " texas                                                        texas  \n",
       " kingdom of denmark                              kingdom of denmark  \n",
       " subgingival plaque                              subgingival plaque  \n",
       " saliva                                                      saliva  \n",
       " oreochromis niloticus                        oreochromis niloticus  \n",
       " \n",
       " [869 rows x 3 columns],\n",
       " array([[ 5.        , 10.        ,  8.33333333, ..., 60.        ,\n",
       "         33.33333333, 43.33333333],\n",
       "        [ 0.        ,  0.        ,  0.        , ...,  0.        ,\n",
       "          0.        , 20.        ],\n",
       "        [ 0.        ,  0.        ,  0.        , ...,  0.        ,\n",
       "          0.        ,  0.        ],\n",
       "        ...,\n",
       "        [20.        , 40.        , 33.33333333, ...,  0.        ,\n",
       "          0.        ,  0.        ],\n",
       "        [ 0.        ,  0.        ,  0.        , ...,  0.        ,\n",
       "          0.        ,  0.        ],\n",
       "        [ 0.        ,  0.        ,  0.        , ...,  0.        ,\n",
       "          0.        ,  0.        ]]),\n",
       "                                                     group  \\\n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGTAGGGTACGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTC...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCAC...    1.0   \n",
       " GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCT...    1.0   \n",
       " TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...    1.0   \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGT...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGC...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...    1.0   \n",
       " TACGGGGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTCT...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...    1.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    1.0   \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...    1.0   \n",
       " TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTAC...    1.0   \n",
       " TACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTC...    1.0   \n",
       " TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCAC...    1.0   \n",
       " TACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGC...    1.0   \n",
       " ...                                                   ...   \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    1.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    0.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    0.0   \n",
       " TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCTC...    0.0   \n",
       " TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGC...    0.0   \n",
       " TACAGAGGATGCTAGCGTTATTCGGAATGAATGGGCGTAAAGAGTCT...    0.0   \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...    0.0   \n",
       " TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGC...    0.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    0.0   \n",
       " TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...    0.0   \n",
       " TACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...    0.0   \n",
       " TACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTC...    0.0   \n",
       " TACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCAC...    0.0   \n",
       " TACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...    0.0   \n",
       " TACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC...    0.0   \n",
       " TACAGAGGGTGCAAGCGTTAATCAGAATGACTGGGCGTAAAGGGCGT...    0.0   \n",
       " TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGC...    0.0   \n",
       " TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTTC...    0.0   \n",
       " TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCTC...    0.0   \n",
       " TTCCAGCTCCAATAGCGTATATAAAAGTTGCTGCAGTTAAAAAGCTC...    0.0   \n",
       " TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGC...    0.0   \n",
       " TACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGT...    0.0   \n",
       " TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTTC...    0.0   \n",
       " TACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTT...    0.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    0.0   \n",
       " TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTC...    0.0   \n",
       " TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCAC...    0.0   \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...    0.0   \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...    0.0   \n",
       " \n",
       "                                                                                              sequence  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGC...  TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCG...  \n",
       " TACGTAGGGTACGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTC...  TACGTAGGGTACGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCT...  \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGC...  TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCG...  \n",
       " TACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCAC...  TACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCA...  \n",
       " GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCT...  GACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTC...  \n",
       " TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGT...  TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCG...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGC...  TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGGGGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTCT...  TACGGGGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTC...  \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC...  TACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCG...  \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...  TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...  TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...  TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGC...  TACGTAGGTGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCG...  \n",
       " TACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTAC...  TACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTA...  \n",
       " TACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTC...  TACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTT...  \n",
       " TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCAC...  TACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCA...  \n",
       " TACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGC...  TACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAG...  \n",
       " ...                                                                                               ...  \n",
       " TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGC...  TACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCTC...  TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCT...  \n",
       " TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGC...  TACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCG...  \n",
       " TACAGAGGATGCTAGCGTTATTCGGAATGAATGGGCGTAAAGAGTCT...  TACAGAGGATGCTAGCGTTATTCGGAATGAATGGGCGTAAAGAGTC...  \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGC...  TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTG...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTC...  TACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCT...  \n",
       " TACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCAC...  TACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCA...  \n",
       " TACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGC...  TACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCG...  \n",
       " TACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC...  TACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCG...  \n",
       " TACAGAGGGTGCAAGCGTTAATCAGAATGACTGGGCGTAAAGGGCGT...  TACAGAGGGTGCAAGCGTTAATCAGAATGACTGGGCGTAAAGGGCG...  \n",
       " TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGC...  TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTG...  \n",
       " TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTTC...  TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTT...  \n",
       " TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCTC...  TTCCAGCTCCAATAGCGTATACTAAAGCTGCTGCGGTTAAAAAGCT...  \n",
       " TTCCAGCTCCAATAGCGTATATAAAAGTTGCTGCAGTTAAAAAGCTC...  TTCCAGCTCCAATAGCGTATATAAAAGTTGCTGCAGTTAAAAAGCT...  \n",
       " TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGC...  TACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTG...  \n",
       " TACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGT...  TACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAG...  \n",
       " TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTTC...  TTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAACGTT...  \n",
       " TACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTT...  TACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCT...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTC...  TACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCT...  \n",
       " TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCAC...  TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGC...  TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAG...  \n",
       " TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCAC...  TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCA...  \n",
       " \n",
       " [78 rows x 2 columns])"
      ]
     },
     "execution_count": 24,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "res"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true,
    "jupyter": {
     "outputs_hidden": true
    }
   },
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.7.9"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 4
}