unsupported operand type(s)

[frankMusacchia]

I am having this problem using the SAM file to identify the off-target

python ~/bin/guideseq-1.0.2/guideseq/guideseq.py identify --aligned ~/Desktop/WORKS/CODE/download/AA_1.sam --target_sequence ctgcgcgctcgctcgctcactgaggccgcccgg --description ABM --genome ~/Desktop/WORKS/CODE/download/ucsc_mm10.fa --outfolder ~/Desktop/WORKS/Analisi/Auricchio/Manel/identify/
[07/08 09:20:09AM][INFO][guideseq] Identifying offtarget sites...
[07/08 09:20:09AM][INFO][identifyOfftargetSites] Processing SAM file /home/francesco/Desktop/WORKS/CODE/download/AA_1.sam
[07/08 09:20:09AM][ERROR][guideseq] Error identifying offtarget sites.
[07/08 09:20:09AM][ERROR][guideseq] Traceback (most recent call last):
File "/home/francesco/bin/guideseq-1.0.2/guideseq/guideseq.py", line 224, in identifyOfftargetSites
identifyOfftargetSites.analyze(samfile, self.reference_genome, self.identified[sample], annotations)
File "/home/francesco/bin/guideseq-1.0.2/guideseq/identifyOfftargetSites.py", line 217, in analyze
chromosome_position.addPositionBarcode(chromosome, read_position, strand, barcode, primer, count)
File "/home/francesco/bin/guideseq-1.0.2/guideseq/identifyOfftargetSites.py", line 66, in addPositionBarcode
self.chromosome_barcode_dict[chromosome][position][strand][barcode] += count
TypeError: unsupported operand type(s) for +=: 'int' and 'NoneType'

Do you know what can be the problem?
I did not use the UMI and started from "align" step

Thanks a lot for youtr time

[EMMA-MGH]

I also have the same issue as you but I follow all the previous steps, no skip of the UMI step.
Do you solve this problem?

[martinaryee]

Are you able to a) check how many reads are in the input SAM file, and b) post a few of the lines from the SAM file?

[ajm-scan]

Using the following command
/mnt/shared/tools/samtools-1.9/samtools stats /mnt/data/projects/103807/Variants/recalibrate/103807-001-0011.sam > /mnt/data/projects/103807/Variants/recalibrate/103807-001-0011.samstats
I retrieved
SN raw total sequences: 801526687
SN filtered sequences: 0
SN sequences: 801526687
SN is sorted: 1
SN 1st fragments: 400727290
SN last fragments: 400799397
SN reads mapped: 800336570

For and example please see the file below

103807-001-0011.small.zip

[sowmyaiyer]

Thank you for providing the information. To help debug further, could you please provide your outputs from the (1) UMItag step and (2) the align step?

Thank you.

[ajm-scan]

I did not use the UMItag step and the align step. The raw data I used does not have any UMI data. The github stated the program can be run in individual parts so I only used already aligned data with the guideseq program for identifying off-target sites.

[skqxys]

Hi, I had the same problem. I didn't use UMI. So I just started from "align".

(guideseq) pan:~/offTarget/GUIDEseq_Data/clean_3rd/downstreamAnalysis$ guideseq.py identify --aligned aligned/px_S81_L003_R1_001.sam --genome ~/reference_genome/hg19/hg19.fa --outfolder ./ --target_sequence '' [08/05 09:07:55PM][INFO][guideseq] Identifying offtarget sites... [08/05 09:07:55PM][INFO][identifyOfftargetSites] Processing SAM file ./aligned/px_S81_L003_R1_001.sam [08/05 09:07:55PM][ERROR][guideseq] Error identifying offtarget sites. [08/05 09:07:55PM][ERROR][guideseq] Traceback (most recent call last): File "/home/pan/miniconda3/envs/guideseq/bin/guideseq.py", line 240, in identifyOfftargetSites self.window_size, self.max_score) File "/home/pan/miniconda3/envs/guideseq/bin/identifyOfftargetSites.py", line 314, in analyze chromosome_position.addPositionBarcode(chromosome, read_position, strand, barcode, primer, count) File "/home/pan/miniconda3/envs/guideseq/bin/identifyOfftargetSites.py", line 60, in addPositionBarcode self.chromosome_barcode_dict[chromosome][position][strand][barcode] += count TypeError: unsupported operand type(s) for +=: 'int' and 'NoneType'

Do you solve this problem?

[laurahernandez-hernandez]

Same problem here,
Anyone would have an advice to solve it?
[08/10 10:55:00PM][INFO][guideseq] Identifying offtarget sites...
[08/10 10:55:00PM][INFO][identifyOfftargetSites] Processing SAM file /home/ngs/Documents/NGS_Analysis/CRISPR_offtarget_test-tools/GUIDE-seq/output/aligned/PTPRC_KO.sam
[08/10 10:55:00PM][ERROR][guideseq] Error identifying offtarget sites.
[08/10 10:55:00PM][ERROR][guideseq] Traceback (most recent call last):
File "/home/ngs/Documents/NGS_Analysis/CRISPR_offtarget_test-tools/GUIDE-seq/guideseq/guideseq/guideseq.py", line 222, in identifyOfftargetSites
identifyOfftargetSites.analyze(samfile, self.reference_genome, self.identified[sample], annotations)
File "/home/ngs/Documents/NGS_Analysis/CRISPR_offtarget_test-tools/GUIDE-seq/guideseq/guideseq/identifyOfftargetSites.py", line 217, in analyze
chromosome_position.addPositionBarcode(chromosome, read_position, strand, barcode, primer, count)
File "/home/ngs/Documents/NGS_Analysis/CRISPR_offtarget_test-tools/GUIDE-seq/guideseq/guideseq/identifyOfftargetSites.py", line 66, in addPositionBarcode
self.chromosome_barcode_dict[chromosome][position][strand][barcode] += count
TypeError: unsupported operand type(s) for +=: 'int' and 'NoneType'

thanks

[Anna-xu408]

Hi, I had the same problem. I didn't use UMI. Do you solve this problem?

[laurahernandez-hernandez]

HI Anna, sorry for not being very helpful but I was not able to find an answer/solution for that. I got frustrated because it seems to be a common problem if you are not using UMIs but nobody could provide a clear solution. All the best, Laura El lun, 26 sept 2022 a las 13:57, Anna-xu408 ***@***.***>) escribió:

…

Hi, I had the same problem. I didn't use UMI. Do you solve this problem? — Reply to this email directly, view it on GitHub <#55 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AQR7CTCLWLKE3BYDHYP2D7DWAGMSPANCNFSM4H6YU27Q> . You are receiving this because you commented.Message ID: ***@***.***>

-- ------ Laura Hernández Hernández London, UK