Releases: hartwigmedical/hmftools
strelka-post-process-v1.5
Added -strelka option to MNVValidatorApplication
purple-v2.25
- Removed unused columns from GeneCopyNumber output
- Added minorAllelePloidy and majorAllelePloidy to copy number output
- Cleaned up names of penalty fields and parameters to be more consistent
purple-v2.24
Fixed bug where recovered SVs were not being used for re-segmentation.
purple-v2.23
Fixed bug where SV VCF samples were being sorted into alphabetical order. Now they will be in same order as input VCF.
Clinvar Filtering
Bachelor will report all nonsense, splice or frameshift variants which affect our included gene list but are not in the blacklist. It will also report variants of other types which are specifically whitelisted.
Whitelist
Any missense inframe indel, synonymous or non-coding variant that is present in clinvar with a significance IN (‘PATHOGENIC’,’LIKELY PATHOGENIC’) or which has conflicting evidence but none of them ‘BENIGN’ or ‘LIKELY_BENIGN’.
Any missense variant with a protein coding change that exactly matches the protein coding change of a variant with a significance in clinvar IN (‘PATHOGENIC’,’LIKELY PATHOGENIC’) or which has conflicting evidence but none of them ‘BENIGN’ or ‘LIKELY_BENIGN’.
Blacklist
- Any nonsense, splice or frameshift variant which is present in clinvar with a significance IN (‘BENIGN’,’LIKELY BENIGN’)
- Gene = BRCA2 + Codon > 3326
- CodingEffect in (‘SPLICE’,’NONE’) AND Type = ‘INDEL’ AND (repeatCount>=8 OR indelSequence == microhomology)
- Any frameshift variant which is offset by another frameshift variant to be net inframe in more than 50% of samples which it is found in our cohort. These will appear as explicit variants in our blacklist configuration
- TSC2 16:2137924 T>TCCCTGCAGTGCAGGAAAGGTAGGGCCGGGTGGGG (rs137854222): This is classified as a frameshift variant by snpeff but overlaps the splice region and has perfect microhomology and so has no net effect on coding or splicing.