Skip to content

Known issues

Guanliang MENG edited this page Jul 25, 2022 · 34 revisions

1. Circularity problem and its solution

How to check:

Have a look at the file *.mitoAssemble.K*.overlap_information, it may have something like this:

>C3252271 overlap between 5' and 3' are 52bp
TGAACGGAATAGTTGGTAATTAGTTTAATCAAAACAAATGATTTCGACTCA

and check the file *.mitoAssemble.K*.mitogenome.fa:

$ head -1  *.mitoAssemble.K*.mitogenome.fa
>C3252271 topology=circular

Because this overlapping region is quite long and not simple repeats (say AAAAAAAA), (in most cases) we can safely say that we have got a circular mitochondrial genome (there are methods to verify this, see XXX).

To do:

  • Use another Circularity check script (I remember I have written one?) which can be aware of the simple repeats

2. Simple repeats found in the overlapping region

Say we have this file *.mitoAssemble.K51.overlap_information:

>C3892882 overlap between 5' and 3' are 9bp
TTTTTTTT

and we have this file *.mitoAssemble.K51.mitogenome.fa:

>C3892882 topology=circular

In this case, it is dubious that the assembled mt genome is circular. In this case, you can just treat the sequence as linear, or try to assemble the mt genome with different kmers (larger or smaller), which might be able to overcome the simple repeat problem. This depends on the goal of your study, e.g., if you are going to use only the PCGs for subsequent analysis and you have got all PCGs already, then a circular (complete) mt genome does not help. The changing breakpoint method mentioned 3. Breakpoint and incomplete genes should also help.

3. Breakpoint and incomplete genes

The summary.txt file:

#Seq_id        Length(bp)     Circularity    Closely_related_species
C3252271       16597          yes             Onychomys leucogaster

#Seq_id        Start  End    Length(bp) Direction  Type   Gene_name  Gene_prodcut                      Total_freq_occurred
--------------------------------------------------------------------------------------------------------------------------
C3252271       14     82     69         +          tRNA   trnR(ucg)  tRNA-Arg                          1
C3252271       84     381    298        +          CDS    ND4L       NADH dehydrogenase subunit 4L     1
.
.
.
C3252271       14568  14772  205        +          CDS    ATP8       ATP synthase F0 subunit 8         1
C3252271       14729  15410  682        +          CDS    ATP6       ATP synthase F0 subunit 6         1
C3252271       16193  16262  70         +          tRNA   trnG(ucc)  tRNA-Gly                          1
C3252271       16262  >16598 337        +          CDS    ND3        NADH dehydrogenase subunit 3      1

Here, the ND3 cannot find its stop codon, but because this sequence is actually circular already, the stop codon of ND3 is at the 5' end of this sequence.

In this case, you can simply manually change the breakpoint of the mitochondrial genome. But be careful, you should find a breakpoint where there is no gene (especially overlapping regions of different genes), for example, here sites between 14772 and 14729, or the site 16262 are not good positions. Instead, Any positions between 15410 and 16193 can be chosen.

After this, you can re-annotate the sequence using the mitoz annotate command, by also providing the fastq files (--fq1 and/or --fq2 options), MitoZ will calculate the sequencing depth of all sites along the mitogenome, which in turn provides more evidence to show if the mitogenome is really complete or not (check the abundance track on the circos.svg and cirvos.png files) --- if the sequencing depth (abundance) around the original breakpoint is normally high like other sites of the mitogenome, not sudden dropping or increasing a lot (which indicates repeats), then the mitogenome is complete.

4. core error

During testing, when I submitted the job to SGE for running, sometimes it generated a core dump file (e.g. core.81923) in the annotation step, I do not know the exact reason yet. But when I locally re-ran the command, the problem resolved. Complicated Conda environments can also induce problems, e.g. I once used a conda installed by another person to create the mitozEnv environment, and I always got missing PCGs in the annotation step.

5. No Circos images generated

Do not know why sometimes even circos --modules shows every required Perl module is installed, MitoZ still fails to run Circos (thus no circos.svg and circos.png files), which results in something like this in the stderr output:

2022-06-01 17:18:53,822 - mitoz.utility.utility - INFO -
cp -r /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.png /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.svg /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.depth.txt /home/gmeng/test/sing/mt_annotation/ttt.ttt.megahit.mitogenome.fa.result
cp: der Aufruf von stat für „/home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.png“ ist nicht möglich: Datei oder Verzeichnis nicht gefunden
cp: der Aufruf von stat für „/home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.svg“ ist nicht möglich: Datei oder Verzeichnis nicht gefunden

2022-06-01 17:18:53,842 - mitoz.utility.utility - ERROR -
Error occured when running command:
cp -r /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.png /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.svg /home/gmeng/test/sing/mt_annotation/tmp_ttt_ttt.megahit.mitogenome.fa_mitoscaf.fa/mt_visualization/circos.depth.txt /home/gmeng/test/sing/mt_annotation/ttt.ttt.megahit.mitogenome.fa.result

Solution:

For each specimen, find the mt_annotation directory:

$ source activate mitozEnv   # or use "mamba" or "conda" instead of "source" the command here.

$ ls  mt_annotation/tmp_*_mitoscaf.fa/mt_visualization/ -d | while read f ; do cd $f ; circos ; cd ../../../ ; done

# to list the resulting files:
$ ls  mt_annotation/tmp_*_mitoscaf.fa/mt_visualization/circos.{svg,png}

If you have multiple specimens within the same directory, for example, /my/project/SampleID_1, /my/project/SampleID_2,

$ cd /my/project/ # go to the project directory containing the assembly directory of each specimen

$ source activate mitozEnv   # or use "mamba" or "conda" instead of "source" the command here.

$ ls  */mt_annotation/tmp_*_mitoscaf.fa/mt_visualization/ -d | while read f ; do cd $f ; circos ; cd ../../../../ ; done
# the '*' here will match your sample IDs

# to list the resulting files:
$ ls  */mt_annotation/tmp_*_mitoscaf.fa/mt_visualization/circos.{svg,png}

# to copy the SVG/PNG files to the resulting directories
# Warning: The below command assumes there is NO '_' in your sample ID
$ ls  */mt_annotation/tmp_*_mitoscaf.fa/mt_visualization/circos.{png,svg} | perl -a -F'/' -ne 'chomp;  $F[2]=~s/tmp\_//; $F[2]=~s/\_mitoscaf\.fa//; my $sample=(split(/\_/,$F[2]))[0]; $F[2]=~s/$sample\_$sample\.//; my $result_dir="$sample/$sample.result/$sample.$sample.$F[2].result"; `cp $_ $result_dir`; '

updates:.

  1. The Singularity version (MitoZ version 3.3) seems good to me, indicating the above problem is probably because my environmental variables on the cluster are somehow complicated (and I do not know the exact reason), if you have the same problem, please try to install mitozEnv into a clean environment or try the Singularity version.

  2. empty depth file

If the XXX.result/XXX.XXX.megahit.mitogenome.fa.result/circos.depth.txt file is empty, it is normal for Circos not to run properly.

6. The option --assembler megahit fails

To specify a specific assembler, use the --assembler option.

Warning: --assembler megahit only accepts paired-end data, which means that you need to provide both --fq1 and --fq2!

7. can not find taxid for XXX, maybe it's a misspelling.

This can happen if:

  1. typo for the value of the --requiring_taxa option.
  2. Your etetoolkit database is broken. Please re-install it by checking https://github.com/linzhi2013/MitoZ/wiki/Installation#3-the-etetoolkit-database.

8. Megahit gets very long sequences.

While Megahit can generate circular mitogenomes, in rare cases, however, it could generate very long "mitogenomes", for example:

$ cat summary.txt
#Seq_id        Length(bp)     Circularity    Closely_related_species
k141_58720     44502          no             

#Seq_id        Start  End    Length(bp) Direction  Type   Gene_name  Gene_prodcut                      Total_freq_occurred
--------------------------------------------------------------------------------------------------------------------------
k141_58720     22299  22368  70         +          tRNA   trnI(gau)  tRNA-Ile                          2
k141_58720     22367  22439  73         -          tRNA   trnQ(uug)  tRNA-Gln                          2
k141_58720     22442  22510  69         +          tRNA   trnM(cau)  tRNA-Met                          2
k141_58720     22511  23520  1010       +          CDS    ND2        NADH dehydrogenase subunit 2      2
k141_58720     23523  23589  67         +          tRNA   trnW(uca)  tRNA-Trp                          2
k141_58720     23591  23659  69         -          tRNA   trnA(ugc)  tRNA-Ala                          2
k141_58720     23662  23731  70         -          tRNA   trnN(guu)  tRNA-Asn                          2
k141_58720     23763  23830  68         -          tRNA   trnC(gca)  tRNA-Cys                          1
k141_58720     23831  23897  67         -          tRNA   trnY(gua)  tRNA-Tyr                          1
k141_58720     23899  25443  1545       +          CDS    COX1       cytochrome c oxidase subunit I    2
k141_58720     25441  25509  69         -          tRNA   trnS(uga)  tRNA-Ser                          3
k141_58720     25513  25580  68         +          tRNA   trnD(guc)  tRNA-Asp                          2
k141_58720     25582  26265  684        +          CDS    COX2       cytochrome c oxidase subunit II   2
k141_58720     26269  26332  64         +          tRNA   trnK(uuu)  tRNA-Lys                          2
k141_58720     26333  26536  204        +          CDS    ATP8       ATP synthase F0 subunit 8         2
k141_58720     26494  27174  681        +          CDS    ATP6       ATP synthase F0 subunit 6         2
k141_58720     27174  27958  785        +          CDS    COX3       cytochrome c oxidase subunit III  2
k141_58720     27958  28025  68         +          tRNA   trnG(ucc)  tRNA-Gly                          2
k141_58720     28031  28372  342        +          CDS    ND3        NADH dehydrogenase subunit 3      1
k141_58720     28374  28440  67         +          tRNA   trnR(ucg)  tRNA-Arg                          1
k141_58720     28443  28739  297        +          CDS    ND4L       NADH dehydrogenase subunit 4L     1
k141_58720     28733  30115  1383       +          CDS    ND4        NADH dehydrogenase subunit 4      1
k141_58720     30111  30177  67         +          tRNA   trnH(gug)  tRNA-His                          1
k141_58720     30178  30236  59         +          tRNA   trnS(gcu)  tRNA-Ser                          3
k141_58720     30236  30305  70         +          tRNA   trnL(uag)  tRNA-Leu                          2
k141_58720     30306  32117  1812       +          CDS    ND5        NADH dehydrogenase subunit 5      1
k141_58720     32114  32635  522        -          CDS    ND6        NADH dehydrogenase subunit 6      1
k141_58720     32636  32704  69         -          tRNA   trnE(uuc)  tRNA-Glu                          1
k141_58720     32710  33852  1143       +          CDS    CYTB       cytochrome b                      1
k141_58720     33855  33921  67         +          tRNA   trnT(ugu)  tRNA-Thr                          1
k141_58720     33922  33989  68         -          tRNA   trnP(ugg)  tRNA-Pro                          1
k141_58720     34957  35022  66         +          tRNA   trnF(gaa)  tRNA-Phe                          1
k141_58720     35025  35972  948        +          rRNA   s-rRNA     12S ribosomal RNA                 1
k141_58720     35973  36042  70         +          tRNA   trnV(uac)  tRNA-Val                          1
k141_58720     36041  37605  1565       +          rRNA   l-rRNA     16S ribosomal RNA                 1
k141_58720     37607  37681  75         +          tRNA   trnL(uaa)  tRNA-Leu                          2
k141_58720     37682  38638  957        +          CDS    ND1        NADH dehydrogenase subunit 1      1
k141_58720     38637  38704  68         +          tRNA   trnI(gau)  tRNA-Ile                          2
k141_58720     38702  38773  72         -          tRNA   trnQ(uug)  tRNA-Gln                          2
k141_58720     38775  38843  69         +          tRNA   trnM(cau)  tRNA-Met                          2
k141_58720     38844  39881  1038       +          CDS    ND2        NADH dehydrogenase subunit 2      2
k141_58720     39880  39946  67         +          tRNA   trnW(uca)  tRNA-Trp                          2
k141_58720     39948  40016  69         -          tRNA   trnA(ugc)  tRNA-Ala                          2
k141_58720     40019  40088  70         -          tRNA   trnN(guu)  tRNA-Asn                          2
k141_58720     40153  41685  1533       +          CDS    COX1       cytochrome c oxidase subunit I    2
k141_58720     41681  41749  69         -          tRNA   trnS(uga)  tRNA-Ser                          3
k141_58720     41753  41820  68         +          tRNA   trnD(guc)  tRNA-Asp                          2
k141_58720     41822  42505  684        +          CDS    COX2       cytochrome c oxidase subunit II   2
k141_58720     42509  42572  64         +          tRNA   trnK(uuu)  tRNA-Lys                          2
k141_58720     42573  42776  204        +          CDS    ATP8       ATP synthase F0 subunit 8         2
k141_58720     42734  43414  681        +          CDS    ATP6       ATP synthase F0 subunit 6         2
k141_58720     43414  44187  774        +          CDS    COX3       cytochrome c oxidase subunit III  2
k141_58720     44195  44262  68         +          tRNA   trnG(ucc)  tRNA-Gly                          2


Protein coding genes totally found: 19
tRNA genes totally found:           32
rRNA genes totally found:            2
--------------------------------------
Genes totally found:                53

And then I checked the duplicate genes, for example, the two COX1 genes and the two ATP8 genes, and found out they are different!

For the correct COX1, it has a sequencing depth of > 40,000 X along the whole gene. But for the wrong COX1, it has sequencing depths from 30X to 200X along the whole gene.

When I blast both COX1 to the NCBI NT database, they both mapped to the target genus.

Thus, be cautious when using the Megahit program for mitogenome assembly! We need to fine-tune the assembly parameters for it! For now, to determine if Megahit's mitogenome is reliable, (1) check the mitogenome length, too long and not circular is definitely problematic; (2) check the sequencing depth along the mitogenome! Be cautious with very high or low regions; (3) Compare the gene sequences to NCBI NT database (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), check if it is your target clade; (4) Compare the results to the results generated by mitoAssemble which are more reliable.

Clone this wiki locally