From 37ee3b90ff37cf1a351c0e346685f15d62af261b Mon Sep 17 00:00:00 2001
From: Nathan LeRoy <NLeRoy917@gmail.com>
Date: Fri, 1 Sep 2023 17:36:51 -0400
Subject: [PATCH 1/2] pydantic updates

---
 .gitignore                   |  1 +
 README.md                    | 20 ++++++++++----------
 optipyzer/request_models.py  |  2 +-
 optipyzer/response_models.py |  8 ++++----
 4 files changed, 16 insertions(+), 15 deletions(-)

diff --git a/.gitignore b/.gitignore
index 21173f7b..c5687fdf 100644
--- a/.gitignore
+++ b/.gitignore
@@ -153,3 +153,4 @@ cython_debug/
 
 .DS_Store
 .Rproj.user
+.python-version
\ No newline at end of file
diff --git a/README.md b/README.md
index babc96a5..9a318e01 100644
--- a/README.md
+++ b/README.md
@@ -30,13 +30,13 @@ import optipyzer
 
 api = optipyzer.API()
 
-gblock = "ATGGCCCTTTAA"
+dna_seq = "ATGGCCCTTTAA"
 
 result = api.optimize(
-        seq=dna_seq,
-        seq_type="dna",
-        weights={"human": 2, "mouse": 1},
-    )
+    seq=dna_seq,
+    seq_type="dna",
+    weights={"human": 2, "mouse": 1},
+)
 
 print(result['optimized_sd'])
 ```
@@ -65,13 +65,13 @@ import optipyzer
 
 api = optipyzer.API(local=True) # <--- specify you are using a local server
 
-gblock = "ATGGCCCTTTAA"
+dna_seq = "ATGGCCCTTTAA"
 
 result = api.optimize(
-        seq=dna_seq,
-        seq_type="dna",
-        weights={"human": 2, "mouse": 1},
-    )
+    seq=dna_seq,
+    seq_type="dna",
+    weights={"human": 2, "mouse": 1},
+)
 
 print(result['optimized_sd'])
 ```
diff --git a/optipyzer/request_models.py b/optipyzer/request_models.py
index b430f56d..869e5168 100644
--- a/optipyzer/request_models.py
+++ b/optipyzer/request_models.py
@@ -10,7 +10,7 @@ class OptimizeQuery(BaseModel):
     seed: Optional[Union[int, str]]
 
     class Config:
-        schema_extra = {
+        json_schema_extra = {
             "description": "The optimization query that includes the sequence, and the organism weights",
             "example": {
                 "seq": "ATGCGTACTAGTCAGTCAGACTGACTG",
diff --git a/optipyzer/response_models.py b/optipyzer/response_models.py
index a76e1a5b..b89dc84f 100644
--- a/optipyzer/response_models.py
+++ b/optipyzer/response_models.py
@@ -1,20 +1,20 @@
-from typing import Dict, List
+from typing import Dict, List, Union
 from pydantic import BaseModel
 
 # model for an optimization result
 class OptimizationResult(BaseModel):
     query: str
-    weights: Dict[str, int]
+    weights: Dict[Union[str, int], int]
     seq_type: str
     peptide_seq: str
     dna_seq: str
     stop_codon: int
     optimized_sd: str
     min_difference_sumsquares: float
-    best_expression_sd: Dict[str, float]
+    best_expression_sd: Dict[Union[str, int], float]
     optimized_ad: str
     min_difference_absvalue: float
-    best_expression_ad: Dict[str, float]
+    best_expression_ad: Dict[Union[str, int], float]
 
     class Config:
         orm_mode = True

From e9290cae51b30524698e615aaf8c097341375b36 Mon Sep 17 00:00:00 2001
From: Nathan LeRoy <NLeRoy917@gmail.com>
Date: Fri, 1 Sep 2023 17:37:21 -0400
Subject: [PATCH 2/2] bump version

---
 optipyzer/const.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/optipyzer/const.py b/optipyzer/const.py
index f94c3557..5817ffb5 100644
--- a/optipyzer/const.py
+++ b/optipyzer/const.py
@@ -1,4 +1,4 @@
-VERSION = "0.2.0"
+VERSION = "0.2.1"
 
 VALID_AMINO_ACIDS = "ARNDCQEGHILKMFPSTWYV"