From 75a4e007a5b07b9cf2dea7c95c62cfb926fce974 Mon Sep 17 00:00:00 2001 From: John Practicalli <250870+practicalli-john@users.noreply.github.com> Date: Fri, 7 Jul 2023 00:50:45 +0100 Subject: [PATCH] challenges: add nucleotide count exercism --- .../exercism/nucleotide-count.md | 373 ++++++++++++++++++ mkdocs.yml | 1 + 2 files changed, 374 insertions(+) create mode 100644 docs/coding-challenges/exercism/nucleotide-count.md diff --git a/docs/coding-challenges/exercism/nucleotide-count.md b/docs/coding-challenges/exercism/nucleotide-count.md new file mode 100644 index 000000000..5988dd6d4 --- /dev/null +++ b/docs/coding-challenges/exercism/nucleotide-count.md @@ -0,0 +1,373 @@ +# Nucleotide Count + +![RNA Transcription](https://github.com/practicalli/graphic-design/blob/live/code-challenges/exercism/rna-transcription.png?raw=true) + +[:globe_with_meridians: Clojure Track: Nucleotide Count](https://exercism.org/tracks/clojure/exercises/nucleotide-count){target=_blank .md-button} + +Given a string representing a DNA sequence, count how many of each nucleotide is present. + +If the string contains characters other than A, C, G, or T then an error should be throw. + +Represent a DNA sequence as an ordered collection of nucleotides, e.g. a string of characters such as "ATTACG". + + +```shell +"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2 +"INVALID" -> error +``` + +!!! INFO "DNA Nucleotide names" + `A` is Adenine, `C` is Cytosine, `G` is Guanine and `T` is Thymine + + +!!! HINT "Code for this solution on GitHub" + [practicalli/exercism-clojure-guides](https://github.com/practicalli/exercism-clojure-guides/) contains the design journal and solution to this exercise and many others. + + +## Create the project + +Download the Nucleotide Count exercise using the exercism CLI tool + +!!! NOTE "" + ```bash + exercism download --exercise=nucleotide-count --track=clojure + ``` + +!!! HINT "Use the REPL workflow to explore solutions locally" + Open the project in a [Clojure aware editor](/clojure/clojure-editors) and [start a REPL](/clojure/coding-challenges/exercism/#repl-workflow), using a rich comment form to experiment with code to solve the challenge. + + +## Starting point + +Unit test code calls functions from the `src` tree which must exist with the correct argument signature for the unit test code to compile successfully. + +Reviewing each assertion in the unit test code identifies the function definitions required. + +??? EXAMPLE "Exercism Unit Tests" + ```clojure + (ns nucleotide-count-test + (:require [clojure.test :refer [deftest is]] + nucleotide-count)) + + (deftest empty-dna-strand-has-no-adenosine + (is (= 0 (nucleotide-count/count-of-nucleotide-in-strand \A, "")))) + + (deftest empty-dna-strand-has-no-nucleotides + (is (= {\A 0, \T 0, \C 0, \G 0} + (nucleotide-count/nucleotide-counts "")))) + + (deftest repetitive-cytidine-gets-counted + (is (= 5 (nucleotide-count/count-of-nucleotide-in-strand \C "CCCCC")))) + + (deftest repetitive-sequence-has-only-guanosine + (is (= {\A 0, \T 0, \C 0, \G 8} + (nucleotide-count/nucleotide-counts "GGGGGGGG")))) + + (deftest counts-only-thymidine + (is (= 1 (nucleotide-count/count-of-nucleotide-in-strand \T "GGGGGTAACCCGG")))) + + (deftest validates-nucleotides + (is (thrown? Throwable (nucleotide-count/count-of-nucleotide-in-strand \X "GACT")))) + + (deftest counts-all-nucleotides + (let [s "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"] + (is (= {\A 20, \T 21, \G 17, \C 12} + (nucleotide-count/nucleotide-counts s))))) + ``` + + +!!! EXAMPLE "Function definitions required to compile unit test code" + ```clojure title="src/nucleotide_count.clj" + (ns nucleotide-count) + + (defn count-of-nucleotide-in-strand + "Count how many of a given nucleotide is in a strand" + [nucleotide strand]) + + (defn nucleotide-counts + "Count all nucleotide in a strand" + [strand]) + ``` + + +## Making the tests pass + +Select one assertion from the unit tests and write code to make the test pass. + +Experiment with solutions in the `comment` form and add the chosen approach to the respective function definition. + + +## Counting nucleotides + +Use test data from the unit test code, e.g. `"GGGGGTAACCCGG"` + +How often does a nucleotide appear + +!!! EXAMPLE + ```clojure + (map + #(if (= % \A) 1 0) + "GGGGGTAACCCGG") + ``` + + +Add the result to get the total count + +!!! EXAMPLE + ```clojure + (count + (map + #(if (= % \A) 1 0) + "GGGGGTAACCCGG")) + ``` + +Is there a more elegant way? + +When only the matching nucleotide is in the strand, then all the elements of the strand can be counted. + +`filter` the DNA strand with a predicate function (returns true/false) that returns only the matching nucleotide. + +!!! EXAMPLE + ```clojure + (filter #(= % \A) valid-nucleotides)) + ``` + + ;; Count the elements in the returned sequence for the total + + +!!! EXAMPLE + ```clojure + (count + (filter #(= % \A) valid-nucleotides)) + ``` + + +Add this code into the starting function + + +### Run unit tests + +Run the unit tests to see if they pass. x should pass, x should fail. + + +### Nucleotide occurances + +Count the occurances + + "GGGGGTAACCCGG" + + +```clojure + (count + (filter (fn [nucleotide] (= nucleotide \A)) + "GGGGGTAACCCGG")) +``` + + +Define the data + +```clojure + (def valid-nucleotides + "Characters representing valid nucleotides" + [\A \C \G \T]) +``` + +Exception handling required + +```clojure +(throw (Throwable.)) if nucleotide is \X +``` + +Or use a predicate with some (some element? in the sequence) + +```clojure + (some #(= \G %) valid-nucleotides) + + (some #{\G} valid-nucleotides) +``` + +```clojure + (defn count-of-nucleotide-in-strand + [nucleotide strand] + (if (some #(= nucleotide %) valid-nucleotides) + (count + (filter #(= nucleotide %) + strand)) + (throw (Throwable.)))) + + (count-of-nucleotide-in-strand \T "GGGGGTAACCCGG") +``` + + +Design the second function + +How often does a nucleotide appear + +```clojure + (map + #(if (= % \A) 1 0) + valid-nucleotides) +``` + +Add the result to get the total count + +Is there a more elegant way? + +```clojure + (filter #(= % \A) valid-nucleotides) +``` + +Count the elements in the returned sequence for the total + +Design the second function + +How often does a nucleotide appear + +NOTE: zero must be returned when there are no appearences + +Return value always in the form + +```clojure + {\A 20, \T 21, \G 17, \C 12} +``` + +### Hammock time... + +- How often does something appear, +- how frequenct is it? +- Is there a clojure standard library for that (approx 700 functions), review + + +```clojure + (frequencies "GGGGGAACCCGG") +``` + +If there are missing nucleotides then there is no answer + +What if there is a starting point + +```clojure + {\A 0 \C 0 \G 0 \T 0} +``` + + ;; Then merge the result of frequencies + +```clojure + (merge {\A 0 \C 0 \G 0 \T 0} + (frequencies "GGGGGAACCCGG")) +``` + +Update the function definition and run tests + + +## Solutions + +There are many ways to solve a challenge and there is value trying different approaches to help learn more about the Clojure language. + +The following solution includes `filter` and `frequencies` functions which are commonly used functions from the Clojure standard library. + +!!! EXAMPLE "Example Solution" + ```clojure title="src/nucleotide_count.clj" + (ns nucleotide-count) + + (def valid-nucleotides + "Characters representing valid nucleotides" + [\A \C \G \T]) + + (defn count-of-nucleotide-in-strand + [nucleotide strand] + (if (some #(= nucleotide %) valid-nucleotides) + (count + (filter #(= nucleotide %) + strand)) + (throw (Throwable.)))) + + (defn nucleotide-counts + "Count all nucleotide in a strand" + [strand] + (merge {\A 0 \C 0 \G 0 \T 0} + (frequencies "GGGGGAACCCGG"))) + ``` + + + + + + + diff --git a/mkdocs.yml b/mkdocs.yml index 43b2ec1b7..c9861825b 100644 --- a/mkdocs.yml +++ b/mkdocs.yml @@ -198,6 +198,7 @@ nav: # - coding-challenges/exercism/hamming.md # - coding-challenges/exercism/space-age.md - RNA Transcription: coding-challenges/exercism/rna-transcription.md + - Nucleotide Count: coding-challenges/exercism/nucleotide-count.md - Bob: - coding-challenges/exercism/bob/index.md - coding-challenges/exercism/bob/bob-string-approach.md