diff --git a/docs/_build/doctrees/environment.pickle b/docs/_build/doctrees/environment.pickle index c24c22e..c515434 100644 Binary files a/docs/_build/doctrees/environment.pickle and b/docs/_build/doctrees/environment.pickle differ diff --git a/docs/_build/doctrees/index.doctree b/docs/_build/doctrees/index.doctree index c73a020..4c726d2 100644 Binary files a/docs/_build/doctrees/index.doctree and b/docs/_build/doctrees/index.doctree differ diff --git a/docs/_build/doctrees/news.doctree b/docs/_build/doctrees/news.doctree index 9b1ef4e..e2d855c 100644 Binary files a/docs/_build/doctrees/news.doctree and b/docs/_build/doctrees/news.doctree differ diff --git a/docs/_build/html/_sources/index.rst.txt b/docs/_build/html/_sources/index.rst.txt index 0d80a8e..46359a5 100644 --- a/docs/_build/html/_sources/index.rst.txt +++ b/docs/_build/html/_sources/index.rst.txt @@ -40,3 +40,9 @@ Indices and tables * :ref:`genindex` * :ref:`modindex` * :ref:`search` + +Citation +======== +If you use Digger in your research, please cite the following paper: +Digger: directed annotation of immunoglobulin and T cell receptor V, D and J gene sequences and assemblies. +Bioinformatics, 2024. `DOI: 10.1093/bioinformatics/btae144 `_. diff --git a/docs/_build/html/genindex.html b/docs/_build/html/genindex.html index 18331df..8e0b673 100644 --- a/docs/_build/html/genindex.html +++ b/docs/_build/html/genindex.html @@ -44,6 +44,8 @@
  • Docker Image
  • Installation
  • Release Notes
    • +
  • Changes in 0.7.3
    • +
  • Changes in 0.7.3

    • Examples

    Examples

    @@ -124,6 +128,12 @@

    Indices and tablesModule Index

  • Search Page

    • + +
    +

    Citation

    +

    If you use Digger in your research, please cite the following paper: +Digger: directed annotation of immunoglobulin and T cell receptor V, D and J gene sequences and assemblies. +Bioinformatics, 2024. DOI: 10.1093/bioinformatics/btae144.

    diff --git a/docs/_build/html/news.html b/docs/_build/html/news.html index 44f5e79..eee902e 100644 --- a/docs/_build/html/news.html +++ b/docs/_build/html/news.html @@ -46,13 +46,16 @@
  • dig-sequence
  • Docker Image
  • Installation
    • -
  • Release Notes
      +
    • Release Notes
      • +
    • Changes in 0.7.3
      • +
    • Changes in 0.7.3
        +
      • Changes in 0.7.2
      • Changes in 0.7.1
      • Changes in 0.7.0
      • Changes in 0.6.9
      • Changes in 0.6.8
      • Changes in 0.6.7
        • -
      • Changes in 0.6.7
        • +
      • Changes in 0.6.7
      • Changes in 0.6.6
      • Changes in 0.6.4
      • Changes in 0.6.3:
        • @@ -112,6 +115,24 @@

        Release Notes

        +
        +
        +

        Changes in 0.7.3

        +
          +

        • fix problem with salmonid names, e.g. TRB3V

          • +
        +
        +
        +

        Changes in 0.7.3

        +
          +

        • fix crash in compare_annotations.py

          • +
        +
        +

        Changes in 0.7.2

        +
          +

        • digger will default to using the starting set of reference genes for comparison, if no sets are specified with -ref_comp.

          • +
        +

        Changes in 0.7.1

          @@ -147,8 +168,8 @@

          Changes in 0.6.7 -

          Changes in 0.6.7

          +
          +

          Changes in 0.6.7

          • better error handling and explanation in parse_imgt_annotations

          • Docker image added

            • diff --git a/docs/_build/html/search.html b/docs/_build/html/search.html index ffb5d85..ce151df 100644 --- a/docs/_build/html/search.html +++ b/docs/_build/html/search.html @@ -47,6 +47,8 @@
          • Docker Image
          • Installation
          • Release Notes
            • +
          • Changes in 0.7.3
            • +
          • Changes in 0.7.3

          Examples

            diff --git a/docs/_build/html/searchindex.js b/docs/_build/html/searchindex.js index 38bc38d..4a6da12 100644 --- a/docs/_build/html/searchindex.js +++ b/docs/_build/html/searchindex.js @@ -1 +1 @@ -Search.setIndex({"docnames": ["docker", "examples/additional_examples", "examples/human_igh", "examples/rhesus_igh", "examples/targeted_annotation", "index", "install", "news", "overview", "tools/annotation", "tools/blastresults_to_csv", "tools/calc_motifs", "tools/compare_annotations", "tools/dig_sequence", "tools/digger", "tools/find_alignments", "tools/parse_imgt_annotations", "usage"], "filenames": ["docker.rst", "examples\\additional_examples.rst", "examples\\human_igh.rst", "examples\\rhesus_igh.rst", "examples\\targeted_annotation.rst", "index.rst", "install.rst", "news.rst", "overview.rst", "tools\\annotation.rst", "tools\\blastresults_to_csv.rst", "tools\\calc_motifs.rst", "tools\\compare_annotations.rst", "tools\\dig_sequence.rst", "tools\\digger.rst", "tools\\find_alignments.rst", "tools\\parse_imgt_annotations.rst", "usage.rst"], "titles": ["Docker Image", "Additional Examples", "Annotating the human IGH locus", "Annotating the rhesus macaque IGH locus", "Targeted Annotation", "Digger: tools for annotating genomic assemblies of the IG/TR receptor loci", "Installation", "Release Notes", "Overview", "Anotation format", "blastresults_to_csv", "calc_motifs", "compare_annotations", "dig_sequence", "digger", "find_alignments", "parse_imgt_annotations", "Commandline Usage"], "terms": {"cover": [1, 4, 8], "ig": [1, 3, 8, 14], "loci": [1, 2, 3, 7, 8], "human": [1, 4, 5, 7, 8, 11, 12, 14, 16], "rhesu": [1, 5, 8, 10, 11, 14, 15], "macaqu": [1, 5, 8, 10, 11, 14, 15], "can": [0, 1, 2, 3, 4, 5, 7, 8, 13, 14, 15], "found": [1, 2, 3, 4, 8, 9, 14, 15], "test": [0, 1, 7], "folder": [1, 14], "digger": [0, 1, 2, 3, 4, 6, 7, 9, 12, 17], "github": [1, 2, 3, 6], "repo": 1, "In": [1, 2, 3, 4, 8, 9, 14], "each": [1, 3, 9, 14, 15], "case": [1, 3, 4, 6, 7, 8], "consist": 1, "script": [1, 2, 3], "file": [1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16], "run_digg": 1, "bat": 1, "which": [1, 2, 3, 4, 7, 8, 9, 14, 15], "download": [1, 2, 3, 6, 8, 16], "necessari": [1, 3, 7, 8, 11], "data": [1, 14], "conduct": [1, 8], "analysi": [1, 2, 3, 7, 8, 9, 13], "result": [1, 2, 3, 8, 10, 12, 14, 15], "despit": 1, "its": [0, 1, 2, 4, 13, 16], "extens": [1, 2], "run": [0, 1, 2, 6, 8], "under": [1, 7, 8], "linux": [0, 1, 6], "shell": [0, 1, 3], "sourc": 1, "window": [0, 1, 6, 8], "For": [1, 6, 13], "gnu": 1, "core": 1, "util": [1, 3, 6, 7], "some": [1, 2, 3, 7, 8], "other": [1, 2, 3, 7, 8, 10, 11, 15], "implement": 1, "simpl": [1, 8], "command": [0, 1, 2, 3, 4, 6, 7, 8, 10, 11, 15], "ar": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15], "requir": [1, 6, 7, 8, 13, 14], "The": [0, 2, 3, 4, 6, 7, 8, 11, 13, 14], "ighv": [2, 9], "grch38": 2, "p12": 2, "ha": [2, 3, 4, 6, 9, 14], "been": [2, 3, 4, 6, 9], "thi": [0, 2, 3, 4, 6, 8, 9, 10, 11, 13, 14, 15], "exampl": [0, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16], "we": [2, 3, 6], "comparison": [2, 3, 12], "reproduc": [2, 3], "us": [0, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16], "step": [2, 3], "below": [2, 3, 6, 8, 9], "repositori": [2, 3], "also": [2, 3, 8, 11, 14, 16], "directori": [0, 2, 3, 6, 7, 13, 14, 15], "pars": [2, 8, 16], "parse_imgt_annot": [2, 3, 7, 8, 11, 17], "save_sequ": [2, 3, 16], "imgt000035": 2, "fasta": [2, 3, 4, 8, 14, 15, 16], "http": [2, 3, 6, 7, 16], "www": [2, 3, 16], "org": [2, 3, 16], "ligmdb": [2, 3, 16], "view": [2, 3, 16], "format": [2, 3, 4, 5, 8, 10, 15, 16], "id": [2, 3, 4, 9, 13, 16], "imgt000035_gen": 2, "csv": [2, 3, 4, 10, 12, 13, 14, 15, 16], "creat": [2, 3, 11, 12, 14, 16], "two": [2, 3, 8], "contain": [0, 2, 3, 8, 9, 11, 13, 14, 15, 16], "sequenc": [2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 16], "co": [2, 7, 9, 16], "ordin": [2, 7, 9, 16], "gene": [2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16], "flank": [2, 3, 8, 9], "region": [2, 3, 4, 7, 9, 13], "set": [2, 3, 6, 7, 8, 11, 13, 14, 15, 16], "from": [0, 2, 3, 4, 6, 8, 9, 11, 13, 14, 15], "receptor_util": [2, 3, 7], "extract_ref": [2, 3], "i": [0, 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15], "instal": [0, 2, 3, 5], "part": [2, 3, 9], "l": [2, 3, 7], "homo": 2, "sapien": 2, "homo_sapiens_ighv_gap": [2, 4], "homo_sapiens_ighv": [2, 4], "homo_sapiens_ighd": 2, "homo_sapiens_ighj": 2, "homo_sapiens_ch": 2, "lastli": 2, "need": [2, 3, 6, 14], "make": [2, 7], "combin": 2, "all": [2, 3, 5, 6, 8, 12], "v": [0, 2, 3, 4, 5, 9, 11, 13, 14, 15], "d": [2, 3, 5, 7, 9, 11, 14], "j": [2, 3, 5, 7, 9, 11, 14], "cat": [2, 3], "homo_sapiens_ighvdj": 2, "With": 2, "place": 2, "instruct": [2, 3, 6], "perform": [2, 8], "v_ref": [2, 14], "d_ref": [2, 14], "j_ref": [2, 14], "v_ref_gap": [2, 14], "ref": [2, 3, 7, 9, 15], "speci": [2, 3, 4, 8, 13, 14, 15], "provid": [2, 3, 4, 6, 8, 9, 13, 14, 15, 16], "germlin": [2, 3, 8, 14], "ani": [2, 7], "identifi": [2, 3, 4, 8, 12, 14, 15], "those": [2, 3, 7, 8], "It": [2, 3, 5, 8, 14, 16], "column": [2, 14], "nearest": 2, "ident": 2, "so": [2, 3, 4, 6, 7, 14], "These": [2, 3, 4, 6, 8, 11], "prefix": [2, 3, 9, 10], "specifi": [2, 3, 4, 7, 8, 9, 13, 14, 15, 16], "argument": [2, 3, 4, 9], "multipl": [2, 3, 4, 7, 8, 10, 14, 15], "pass": 2, "allow": [2, 4, 7, 14], "tell": 2, "intern": 2, "posit": [2, 7, 8, 9], "weight": [2, 8, 9, 14], "matric": [2, 8, 11, 14], "A": [2, 3, 4, 8], "sampl": 2, "copi": [2, 7, 11], "summaris": [2, 12], "progress": 2, "call": [2, 3, 7, 8], "follow": [0, 2, 3, 5, 6, 9, 11], "tool": [2, 3, 4, 8, 13], "makeblastdb": [2, 3, 6], "blast": [2, 3, 4, 6, 7, 8, 9, 10, 14, 15], "databas": [2, 3, 6], "blastn": [2, 3, 6], "against": [2, 3], "blastresults_to_csv": [2, 3, 8, 15, 17], "convert": [2, 3, 8, 10], "simpler": 2, "find_align": [2, 3, 7, 8, 9, 17], "align": [2, 3, 4, 7, 13, 14, 15], "compare_annot": [2, 3, 8, 17], "summari": [2, 4, 8], "here": [2, 3], "forward": [2, 3, 12, 14, 15], "comparison_result": 2, "final": [2, 11], "should": [2, 6, 14, 15], "put": 2, "name": [2, 3, 7, 9], "three": [2, 8, 12], "produc": [2, 3, 8, 9, 11, 12, 13, 15], "differ": [2, 4, 7, 9, 12, 14], "graphic": 2, "jpg": [2, 12], "text": [2, 16], "list": [2, 3, 6, 8, 11, 12, 13, 14, 16], "function": [2, 3, 4, 5, 7, 11, 12, 14], "txt": [2, 12], "detail": [2, 4, 14], "line": [0, 2, 6, 8], "accord": 2, "an": [2, 3, 4, 7, 8, 12, 13, 14, 16], "addit": [2, 3, 5, 7, 9], "2": [2, 6, 9], "one": [2, 3, 8, 10, 12, 14, 16], "comparison_results_not": 2, "add": [2, 7], "commentari": 2, "unusu": 2, "variat": [2, 8], "rss": [2, 3, 5, 8, 9, 11, 12, 14], "caus": [2, 3, 7], "orf": [2, 5, 9], "ground": 2, "seen": 2, "rearrang": 2, "current": [0, 2, 3, 6], "although": 2, "tabl": [2, 3, 9], "There": [2, 8], "present": [2, 5, 13, 15], "clear": 2, "univers": 2, "accept": 2, "criteria": 2, "categoris": 2, "minor": [2, 7], "natur": 2, "expect": [2, 3, 8, 9, 11], "over": 2, "next": [2, 3], "few": 2, "year": [2, 14], "see": [2, 3, 6, 9], "genom": [2, 3, 8, 13], "express": 2, "repertoir": 2, "across": [2, 3], "subject": 2, "deeper": 2, "understand": [2, 3], "develop": [2, 6], "overal": [2, 3], "manual": 2, "supervis": 2, "curat": 2, "show": [2, 3, 8, 12], "good": [2, 8, 14], "level": 2, "agreement": [2, 12], "possibl": [2, 3, 4, 14], "mai": [2, 3, 6, 11, 14, 15], "chang": 2, "note": [2, 3, 4, 5, 6, 9, 14], "thei": [2, 3, 4], "base": [2, 7, 8, 11], "revis": 2, "time": [2, 14, 15], "lefranc": 2, "et": [2, 3], "al": [2, 3], "2015": 2, "immunogenet": 2, "inform": [2, 4, 8, 13, 15], "system": [2, 3], "25": 2, "nucleic": 2, "acid": [2, 9, 11], "re": 2, "doi": [2, 3], "10": [2, 3, 6], "1093": 2, "nar": 2, "gku1056": 2, "watson": 2, "2013": 2, "complet": [2, 14], "haplotyp": 2, "immunoglobulin": [2, 5, 8], "heavi": [2, 11], "chain": [2, 11], "variabl": [2, 6, 7], "divers": [2, 3], "join": 2, "character": 2, "allel": [2, 7, 13], "number": [2, 3, 4, 7, 8, 9, 11, 13, 14], "am": 2, "hum": 2, "genet": 2, "1016": 2, "ajhg": 2, "03": 2, "004": 2, "schneider": 2, "2017": 2, "evalu": [2, 3, 9, 14], "de": [2, 8, 15], "novo": [2, 8, 15], "haploid": 2, "demonstr": 2, "endur": 2, "qualiti": 2, "research": 2, "1101": 2, "gr": 2, "213611": 2, "116": 2, "how": [3, 8], "exist": [3, 8, 10], "imgt": [3, 5, 7, 8, 9, 12, 14, 16], "underli": [3, 8], "might": 3, "when": [3, 7], "contig": [3, 7, 9, 14, 15], "scaffold": 3, "2006": 3, "mmul_051212": 3, "lie": 3, "within": [0, 3], "bring": 3, "them": 3, "togeth": 3, "singl": [3, 4, 8, 11], "motif": [3, 4, 7, 11, 13, 14, 15], "deriv": [3, 8], "rhemac10": 3, "mmul_10": 3, "while": [3, 6], "somewhat": 3, "artifici": 3, "could": [3, 7, 14], "equal": 3, "well": [3, 8], "handl": [3, 7], "individu": [3, 10, 11, 15], "approach": 6, "where": [3, 4, 7, 8], "process": [3, 14], "larg": [5, 13], "serv": 3, "packag": [3, 4, 6, 7, 8, 13, 14, 15], "flexibl": 3, "tune": 3, "search": [3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15], "illustr": 3, "work": [0, 3, 7, 14], "git": 3, "As": [3, 4], "previou": 3, "howev": [3, 8], "gap": [3, 4, 7, 9, 13, 14, 15], "insert": [3, 14], "codon": [3, 9, 11, 14], "rel": [3, 9], "convent": 3, "alongsid": 3, "further": [3, 14], "realign": 3, "fix_macaque_gap": 3, "macaca": 3, "mulatta": 3, "macaca_mulatta_ighv_gap": 3, "macaca_mulatta_ighv_gapped_fix": 3, "macaca_mulatta_ighv": 3, "macaca_mulatta_ighd": 3, "macaca_mulatta_ighj": 3, "macaca_mulatta_ighvdj": 3, "mmul_51212": 3, "nw_001157919": 3, "action": 3, "nw_001157919_gene": 3, "nw_001122023": 3, "nw_001122023_gene": 3, "nw_001122024": 3, "nw_001122024_gene": 3, "nw_001121239": 3, "nw_001121239_gene": 3, "nw_001121240": 3, "nw_001121240_gene": 3, "alreadi": [3, 8, 16], "pwm": [3, 8], "purpos": 3, "featur": [3, 5, 11, 16], "access": [3, 4, 8, 13], "imgt000064": [3, 16], "determin": [3, 8, 14], "calcul": 3, "mkdir": 3, "cd": [0, 3], "imgt000064_gen": 3, "calc_motif": [3, 8, 14, 17], "option": [3, 4, 13, 16], "conserved_motif": 3, "defin": 3, "strongli": 3, "conserv": [3, 8, 9, 14], "nucleotid": [3, 4, 9, 14], "leader": [3, 5, 8, 9, 11, 12, 14], "onli": [3, 4, 9, 11, 12, 15], "filenam": [3, 6], "were": [3, 7, 9, 10, 12], "figur": 3, "3": [3, 6, 9, 11], "ngoun": 3, "2022": 3, "heptam": [3, 9], "cac": 3, "g": [3, 5, 7, 8, 9, 11, 16], "nonam": [3, 9], "aacc": 3, "5": [3, 9, 11], "gtg": 3, "t": [3, 5, 6], "c": [3, 4], "tgtg": 3, "gtt": 3, "tg": 3, "again": [3, 14], "locat": [3, 9, 14, 15], "top": 3, "presenc": [3, 15], "absenc": 3, "guid": [3, 4], "like": [3, 14], "pleas": [0, 3, 6, 8, 10, 11, 12, 14, 15, 16], "bear": 3, "mind": 3, "except": 3, "particularli": 3, "definit": [3, 7, 9, 11], "have": [3, 8, 14], "built": [3, 8, 14], "limit": 3, "abl": [3, 6], "directli": [3, 4, 8], "start": [0, 3, 4, 8, 9, 11, 14], "queri": [3, 7, 10], "dbtype": 3, "nucl": 3, "db": 3, "out": 3, "mmul_ighv": 3, "outfmt": 3, "7": [3, 4, 10], "gapopen": 3, "gapextend": 3, "penalti": 3, "1": [3, 4, 6, 9], "word_siz": 3, "11": [3, 6], "mmul_ighd": 3, "100": [3, 4], "mmul_ighj": 3, "higher": 3, "quit": 3, "short": 3, "more": [3, 7, 8, 9, 10, 14], "conveni": [0, 3], "mmul_ighvdj_": 3, "merg": 3, "hit": [3, 14], "achiev": 3, "same": [3, 8], "append": [3, 10], "record": 3, "wa": [3, 7, 9], "per": 3, "modifi": [3, 6, 7, 11], "ensur": 3, "compat": [3, 7], "now": [3, 7], "mmul_ighvdj_nw_": 3, "motif_dir": [3, 13, 14, 15], "third": [3, 8], "wildcard": [3, 15], "match": [3, 4, 7, 8, 9, 12, 13, 14, 15], "quot": 3, "avoid": 3, "expans": 3, "templat": 3, "fix": [3, 7], "attempt": [3, 5, 15], "deduc": 3, "sens": [3, 4, 7, 9, 12, 14, 15], "segment": 3, "help": [0, 3, 6], "vari": 3, "orient": 3, "rather": [3, 4, 7], "than": [3, 4, 7], "would": [3, 14], "capabl": 3, "unfortun": 3, "split": [3, 10], "up": 3, "head": 3, "n": 3, "mmul_head": 3, "cp": 3, "nw_001157919_digger": 3, "grep": 3, "nw_001122023_digger": 3, "nw_001122024_digger": 3, "nw_001121239_digger": 3, "nw_001121240_digger": 3, "nw_001157919_comp": 3, "nw_001122023_comp": 3, "nw_001122024_comp": 3, "nw_001121239_comp": 3, "nw_001121240_comp": 3, "One": 9, "who": [], "report": 7, "r": [], "find": [6, 14, 15], "potenti": [3, 14], "thes": [], "li": [], "extrem": 3, "end": [3, 4, 7, 8, 9], "fulli": [], "repres": 13, "issu": 7, "total": 3, "13": 3, "four": 3, "five": 3, "ighd": 3, "known": 3, "occupi": 3, "small": [3, 5, 13], "distinct": 3, "toward": 3, "therefor": 3, "reason": [3, 8], "given": [3, 8, 11, 13, 15, 16], "technologi": 3, "avail": [0, 3, 4, 6, 8, 13], "length": [3, 4, 7, 8, 11], "correctli": [3, 7, 14], "assembl": 3, "anoth": [3, 8], "suspect": 3, "3nt": 3, "1nt": 3, "yet": 3, "appear": 3, "contrast": 3, "outsid": [3, 14], "biocur": 3, "monkei": 3, "vaccin": 3, "3390": 3, "vaccines10030394": 3, "warren": 3, "2020": 3, "analys": 3, "improv": [3, 7], "enhanc": 3, "Its": [3, 8], "biomed": 3, "scienc": 3, "1126": 3, "abc6617": 3, "gibb": 3, "2007": 3, "evolutionari": 3, "insight": 3, "1139247": 3, "far": 4, "mani": [4, 14], "receptor": [4, 6, 7, 8, 13], "wide": 4, "rang": 4, "companion": 4, "dig_sequ": [4, 7, 8, 17], "closest": [4, 7, 8, 9, 14], "onlin": 4, "ighv1": 4, "18": 4, "04": 4, "genbank": [4, 7, 8, 13], "kc713938": 4, "01": 4, "user": [4, 6, 7], "william": 4, "miniconda3": 4, "env": 4, "digby_genomics310": 4, "lib": 4, "site": 4, "igh": [4, 5, 8, 10, 11, 12, 14, 15, 16], "target_allel": 4, "genbank_acc": [4, 13], "genbank_seq": 4, "935nt": 4, "gene_seq": 4, "atggactggacctggagcatccttttcttggtggcagcagcaacaggtaacggactccccagtcccagggctgagagagaaaccaggccagtcatgtgagacttcacccactcctgtgtcctctccacaggtgcccactcccaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacacagtgtgaaaacccacatcctgagggtttcagaaacc": 4, "seq": [4, 9], "caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga": 4, "alignment_scor": 4, "99": 4, "nt_diff": [4, 7], "snp": 4, "_t111c": 4, "392": 4, "687": 4, "l_part1": [4, 9], "atggactggacctggagcatccttttcttggtggcagcagcaacag": 4, "l_part2": [4, 9], "gtgcccactcc": 4, "v_heptam": [4, 9], "cacagtg": 4, "v_nonam": [4, 9], "tcagaaacc": 4, "take": [4, 15], "includ": [4, 6, 7, 9, 11, 12, 14], "otherwis": [4, 15], "assum": 4, "refer": [4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16], "If": [4, 6, 9, 10, 14], "output": [4, 10, 12, 13, 14, 15, 16], "out_fil": [4, 13], "written": 4, "standard": 4, "sequenec": 4, "return": 4, "regulatori": 4, "variant": 4, "toolkit": [5, 8], "automat": [5, 6, 14, 15], "unrearrang": 5, "b": 5, "cell": 5, "both": [5, 8, 12, 14], "entir": [5, 9, 13], "fragment": 5, "locu": [5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16], "e": [5, 7, 8, 9, 11, 16], "exclud": 5, "utr": [5, 7], "classifi": 5, "pseudogen": [5, 9], "practc": 5, "overview": 5, "dig": 5, "releas": 5, "target": [5, 7, 8, 12, 13], "commandlin": 5, "anot": 5, "index": 5, "modul": 5, "page": [5, 6, 9], "latest": [0, 6], "stabl": 6, "version": [0, 6], "pypi": 6, "python": [6, 11], "9": 6, "abov": [6, 9], "No": 6, "just": [6, 13, 14], "execut": 6, "onc": 6, "verifi": [6, 8], "type": [6, 9], "everyth": 6, "ok": 6, "usag": [6, 10, 11, 12, 13, 14, 15, 16], "you": [0, 6, 8, 14], "encount": 6, "error": [6, 7], "cannot": 6, "alloc": 6, "memori": 6, "come": [6, 14], "environ": 6, "blastdb_lmdb_map_s": 6, "100000000": 6, "easiest": 6, "wai": 6, "itself": [6, 8], "pip": 6, "biopython": 6, "support": [6, 7], "move": 7, "trp": 7, "suppli": [7, 14], "email": [7, 13], "address": [7, 13], "request": [7, 13], "bump": 7, "ad": 7, "tra": [7, 11, 12, 16], "trb": [7, 16], "trd": [7, 12, 16], "trg": [7, 16], "tr": [7, 8], "unintend": 7, "breakpoint": 7, "fire": 7, "circumst": 7, "erron": 7, "leader1": 7, "variou": 7, "effect": 7, "lead": 7, "neg": 7, "coordin": 7, "annot": [7, 8, 10, 11, 12, 13, 14, 15, 16], "properli": 7, "url": [7, 16], "longer": 7, "utilis": 7, "nt": [7, 11], "between": [7, 8, 11], "updat": 7, "code": [7, 8, 9, 13], "bio": 7, "pairwise2": 7, "deprec": 7, "40": 7, "speed": 7, "optimis": 7, "without": 7, "paramet": [3, 7, 11], "non": 7, "revers": [7, 9, 12, 14, 15], "fals": [7, 10, 12, 13, 14, 15], "being": 7, "filter": [7, 12], "store": [7, 14, 16], "local": 7, "specif": [3, 6, 7, 8, 12], "refactor": 7, "element": 7, "modular": 7, "easier": 7, "maintain": 7, "first": [7, 8, 9], "public": 7, "princip": 8, "similar": [6, 8, 14], "most": [8, 9], "determinng": [], "full": [8, 14], "discov": [8, 14], "slower": 8, "assembli": [7, 8, 14, 15, 16], "input": [8, 9], "point": [8, 14], "studi": 8, "ideal": 8, "obtain": [6, 8], "prefer": 8, "close": 8, "relat": 8, "intend": 8, "straightforward": 8, "familiar": 8, "approxim": 8, "extend": [8, 14], "either": [8, 12, 14], "check": [8, 15], "mean": [8, 9], "establish": 8, "canon": [8, 14], "form": 8, "observ": 8, "tailor": 8, "interest": 8, "initi": [8, 14], "": [6, 7, 8, 9, 12, 14], "select": [8, 14, 15], "brief": 8, "subsidiari": 8, "section": 8, "explain": 8, "second": [8, 9], "gener": 8, "mode": 8, "describ": [0, 8, 9, 13], "descript": 8, "tabular": 8, "compar": [8, 9, 12, 14, 15], "tabul": 8, "ord": 9, "start_rev": 9, "prime": 9, "end_rev": 9, "gene_typ": 9, "gene_start": 9, "gene_end": 9, "likelihood": 9, "random": 9, "equenc": 9, "j_heptam": 9, "j_nonam": 9, "j_frame": 9, "frame": 9, "0": [6, 9, 11], "d_3_heptam": 9, "d_3_nonam": 9, "d_5_heptam": 9, "d_5_nonam": 9, "aa": 9, "amino": [9, 11], "translat": 9, "gene_aligned_aa": 9, "seq_gap": 9, "5_rss_start": 9, "5_rss_start_rev": 9, "5_rss_end": 9, "5_rss_end_rev": 9, "3_rss_start": 9, "3_rss_start_rev": 9, "3_rss_end": 9, "3_rss_end_rev": 9, "l_part1_start": 9, "l_part1_start_rev": 9, "l_part1_end": 9, "l_part1_end_rev": 9, "l_part2_start": 9, "l_part2_start_rev": 9, "l_part2_end": 9, "l_part2_end_rev": 9, "blast_match": 9, "highest": [9, 14], "score": 9, "blast_scor": 9, "blast_nt_diff": 9, "highli": 9, "_match": 9, "_score": 9, "_nt_diff": 9, "assign": 9, "meet": 9, "exce": 9, "matrix": 9, "threshold": 9, "agre": 9, "atg": 9, "splice": [9, 11], "stop": 9, "befor": [9, 11], "cystein": 9, "104": 9, "donor": 9, "condit": 9, "met": 9, "detect": 9, "pseudo": 9, "doe": 9, "separ": [10, 14, 15], "h": [10, 11, 12, 13, 14, 15, 16], "infil": 10, "out_prefix": 10, "default": [10, 12, 13, 14, 15], "field": 11, "mark": 11, "consid": [11, 12], "valu": 11, "j_trp_motif": 11, "fgxg": 11, "wgxg": 11, "j_trp_offset": 11, "j_splice": 11, "v_rss_space": 11, "spacer": 11, "j_rss_space": 11, "d_5_rss_space": 11, "d_3_rss_space": 11, "feat_fil": 11, "parse_annot": 12, "venn": 12, "diagram": 12, "oppos": 12, "mmethod": 12, "nc": 12, "filter_annot": 12, "comp_nam": 12, "target_locu": 12, "digger_result": 12, "annotation_fil": 12, "outfil": [12, 16], "parse_imgt_assembly_x": 12, "py": [12, 15], "best": 13, "fetch": 13, "must": [13, 14], "api": 13, "nomin": 13, "debug": [13, 15], "germline_fil": [13, 15], "query_fil": 13, "ungap": [13, 14, 15], "probabl": [13, 14, 15], "parsing_error": [13, 15], "email_addr": 13, "read": [13, 14, 15], "correspond": [13, 14], "associ": 13, "former": 14, "nonfunct": 14, "ref_comp": 14, "keepwf": 14, "assembly_fil": [14, 15], "output_fil": [14, 15], "pathnam": 14, "novel": [7, 14], "comma": [14, 15], "eg": [14, 15], "mous": [14, 15], "repeat": [14, 15], "omit": 14, "keep": 14, "after": 14, "At": 14, "least": 14, "whatev": 14, "practic": 14, "do": [6, 14], "partial": 14, "logic": 14, "postion": 14, "rhesus_macaqu": 14, "conjunct": 14, "correct": 14, "altern": [6, 14], "custom": 14, "gep": 14, "order": 14, "extran": 14, "particular": 14, "introduc": 14, "recent": 14, "wish": 14, "proxim": 14, "choos": 14, "elicit": 14, "shown": 14, "decid": 14, "whether": 14, "made": 14, "right": 14, "choic": 14, "valid": 15, "blast_fil": 15, "glob": 15, "build": 16, "save_download": 16, "save_imgt_annot": 16, "imgt_url": 16, "content": 16, "igk": 16, "igl": 16, "save": 16, "addition": 3, "motif_param": 3, "json": 3, "descrb": 3, "bk063799": 2, "crash": 7, "miss": 7, "docker": [5, 7], "imag": [5, 7], "depend": [0, 7], "document": [0, 7], "hub": 0, "williamle": 0, "pull": 0, "To": 0, "mac": [0, 6], "pwd": 0, "scratch": 0, "bash": 0, "Or": 0, "prompt": 0, "mount": 0, "conda": 6, "anaconda": 6, "recommend": 6, "bioconda": 6, "link": 6, "better": 7, "explan": 7, "load": 6, "share": 6, "librari": 6, "libnsl": 6, "precis": 6, "platform": 6, "guidanc": 6, "through": 6, "googl": 6, "ncbi": 6, "ask": 6, "brows": 6, "ftp": 6, "nlm": 6, "nih": 6, "gov": 6, "browser": 6, "ceas": 6, "your": 6, "won": 6, "open": 6, "curl": 6, "12": 6, "win64": 6, "ex": 6, "o": 6, "reflect": 6, "On": 6, "new": 6, "part1": 7, "part2": 7, "identif": 7, "tata_box": 7, "octam": 7, "promot": 7, "dockeris": 7, "makedb": 7}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"addit": 1, "exampl": [1, 5], "annot": [2, 3, 4, 5, 9], "human": 2, "igh": [2, 3], "locu": [2, 3], "data": [2, 3], "assembli": [2, 3, 5], "compar": [2, 3], "output": [2, 3], "imgt": 2, "": [2, 3], "refer": [2, 3], "rhesu": 3, "macaqu": 3, "prepar": 3, "posit": [3, 10, 11, 12, 13, 14, 15, 16], "weight": 3, "matric": 3, "studi": 3, "target": 4, "digger": [5, 8, 14], "tool": 5, "genom": 5, "ig": 5, "tr": 5, "receptor": 5, "loci": 5, "get": 5, "start": 5, "usag": [5, 17], "document": 5, "indic": 5, "tabl": 5, "instal": 6, "releas": 7, "note": 7, "chang": 7, "0": 7, "6": 7, "3": 7, "2": 7, "1": 7, "v": 7, "5": 7, "10": 7, "9": 7, "8": 7, "7": 7, "4": 7, "version": 7, "april": 7, "2023": 7, "overview": 8, "scope": 8, "featur": 8, "pipelin": 8, "dig": 8, "sequenc": 8, "anot": 9, "format": 9, "column": 9, "file": 9, "function": 9, "blastresults_to_csv": 10, "argument": [10, 11, 12, 13, 14, 15, 16], "name": [10, 12, 13, 14, 15, 16], "calc_motif": 11, "compare_annot": 12, "dig_sequ": 13, "sub": 13, "command": 13, "fasta": 13, "singl": 13, "multi": 13, "multi_seq": 13, "find_align": 15, "parse_imgt_annot": 16, "commandlin": 17, "docker": 0, "imag": 0}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.viewcode": 1, "sphinx": 57}, "alltitles": {"Docker Image": [[0, "docker-image"]], "Additional Examples": [[1, "additional-examples"]], "Annotating the human IGH locus": [[2, "annotating-the-human-igh-locus"]], "Data": [[2, "data"], [3, "data"]], "Annotating the Assembly": [[2, "annotating-the-assembly"], [3, "annotating-the-assembly"]], "Comparing the output to IMGT\u2019s annotation": [[2, "comparing-the-output-to-imgt-s-annotation"]], "References": [[2, "references"], [3, "references"]], "Annotating the rhesus macaque IGH locus": [[3, "annotating-the-rhesus-macaque-igh-locus"]], "Preparing position-weighted matrices": [[3, "preparing-position-weighted-matrices"]], "Comparing the output to the study\u2019s annotation": [[3, "comparing-the-output-to-the-study-s-annotation"]], "Targeted Annotation": [[4, "targeted-annotation"]], "Digger: tools for annotating genomic assemblies of the IG/TR receptor loci": [[5, "digger-tools-for-annotating-genomic-assemblies-of-the-ig-tr-receptor-loci"]], "Getting Started": [[5, null]], "Examples": [[5, null]], "Usage Documentation": [[5, null]], "Indices and tables": [[5, "indices-and-tables"]], "Installation": [[6, "installation"]], "Overview": [[8, "overview"]], "digger": [[8, "digger"], [14, "digger"]], "Scope and Features": [[8, "scope-and-features"]], "Pipeline": [[8, "pipeline"]], "dig-sequence": [[8, "dig-sequence"]], "Anotation format": [[9, "anotation-format"]], "Columns in the Annotation File": [[9, "columns-in-the-annotation-file"]], "Functionality": [[9, "functionality"]], "blastresults_to_csv": [[10, "blastresults-to-csv"]], "Positional Arguments": [[10, "positional-arguments"], [11, "positional-arguments"], [12, "positional-arguments"], [13, "positional-arguments"], [13, "positional-arguments_repeat1"], [13, "positional-arguments_repeat2"], [13, "positional-arguments_repeat3"], [15, "positional-arguments"], [16, "positional-arguments"], [14, "positional-arguments"]], "Named Arguments": [[10, "named-arguments"], [12, "named-arguments"], [13, "named-arguments"], [13, "named-arguments_repeat1"], [13, "named-arguments_repeat2"], [13, "named-arguments_repeat3"], [15, "named-arguments"], [16, "named-arguments"], [14, "named-arguments"]], "calc_motifs": [[11, "calc-motifs"]], "compare_annotations": [[12, "compare-annotations"]], "dig_sequence": [[13, "dig-sequence"]], "Sub-commands": [[13, "Sub-commands"]], "fasta": [[13, "fasta"]], "single": [[13, "single"]], "multi": [[13, "multi"]], "multi_seq": [[13, "multi_seq"]], "find_alignments": [[15, "find-alignments"]], "parse_imgt_annotations": [[16, "parse-imgt-annotations"]], "Commandline Usage": [[17, "commandline-usage"]], "Release Notes": [[7, "release-notes"]], "Changes in 0.7.1": [[7, "changes-in-0-7-1"]], "Changes in 0.7.0": [[7, "changes-in-0-7-0"]], "Changes in 0.6.9": [[7, "changes-in-0-6-9"]], "Changes in 0.6.8": [[7, "changes-in-0-6-8"]], "Changes in 0.6.7": [[7, "changes-in-0-6-7"], [7, "id1"]], "Changes in 0.6.6": [[7, "changes-in-0-6-6"]], "Changes in 0.6.4": [[7, "changes-in-0-6-4"]], "Changes in 0.6.3:": [[7, "changes-in-0-6-3"]], "Changes in 0.6.2:": [[7, "changes-in-0-6-2"]], "Changes in 0.6.1:": [[7, "changes-in-0-6-1"]], "Changes in 0.6.0:": [[7, "changes-in-0-6-0"]], "Changes in v 0.5.10:": [[7, "changes-in-v-0-5-10"]], "Changes in v 0.5.9:": [[7, "changes-in-v-0-5-9"]], "Changes in v 0.5.8:": [[7, "changes-in-v-0-5-8"]], "Changes in v 0.5.7:": [[7, "changes-in-v-0-5-7"]], "Changes in v 0.5.6:": [[7, "changes-in-v-0-5-6"]], "Changes in v 0.5.5:": [[7, "changes-in-v-0-5-5"]], "Changes in V 0.5.4:": [[7, "changes-in-v-0-5-4"]], "Changes in V 0.5.3:": [[7, "changes-in-v-0-5-3"]], "Changes in V 0.5.2:": [[7, "changes-in-v-0-5-2"]], "Changes in V 0.5.1:": [[7, "changes-in-v-0-5-1"]], "Version 0.5: April 2023": [[7, "version-0-5-april-2023"]]}, "indexentries": {}}) \ No newline at end of file +Search.setIndex({"docnames": ["docker", "examples/additional_examples", "examples/human_igh", "examples/rhesus_igh", "examples/targeted_annotation", "index", "install", "news", "overview", "tools/annotation", "tools/blastresults_to_csv", "tools/calc_motifs", "tools/compare_annotations", "tools/dig_sequence", "tools/digger", "tools/find_alignments", "tools/parse_imgt_annotations", "usage"], "filenames": ["docker.rst", "examples\\additional_examples.rst", "examples\\human_igh.rst", "examples\\rhesus_igh.rst", "examples\\targeted_annotation.rst", "index.rst", "install.rst", "news.rst", "overview.rst", "tools\\annotation.rst", "tools\\blastresults_to_csv.rst", "tools\\calc_motifs.rst", "tools\\compare_annotations.rst", "tools\\dig_sequence.rst", "tools\\digger.rst", "tools\\find_alignments.rst", "tools\\parse_imgt_annotations.rst", "usage.rst"], "titles": ["Docker Image", "Additional Examples", "Annotating the human IGH locus", "Annotating the rhesus macaque IGH locus", "Targeted Annotation", "Digger: tools for annotating genomic assemblies of the IG/TR receptor loci", "Installation", "Release Notes", "Overview", "Anotation format", "blastresults_to_csv", "calc_motifs", "compare_annotations", "dig_sequence", "digger", "find_alignments", "parse_imgt_annotations", "Commandline Usage"], "terms": {"cover": [1, 4, 8], "ig": [1, 3, 8, 14], "loci": [1, 2, 3, 7, 8], "human": [1, 4, 5, 7, 8, 11, 12, 14, 16], "rhesu": [1, 5, 8, 10, 11, 14, 15], "macaqu": [1, 5, 8, 10, 11, 14, 15], "can": [0, 1, 2, 3, 4, 5, 7, 8, 13, 14, 15], "found": [1, 2, 3, 4, 8, 9, 14, 15], "test": [0, 1, 7], "folder": [1, 14], "digger": [0, 1, 2, 3, 4, 6, 7, 9, 12, 17], "github": [1, 2, 3, 6], "repo": 1, "In": [1, 2, 3, 4, 8, 9, 14], "each": [1, 3, 9, 14, 15], "case": [1, 3, 4, 6, 7, 8], "consist": 1, "script": [1, 2, 3], "file": [1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16], "run_digg": 1, "bat": 1, "which": [1, 2, 3, 4, 7, 8, 9, 14, 15], "download": [1, 2, 3, 6, 8, 16], "necessari": [1, 3, 7, 8, 11], "data": [1, 14], "conduct": [1, 8], "analysi": [1, 2, 3, 7, 8, 9, 13], "result": [1, 2, 3, 8, 10, 12, 14, 15], "despit": 1, "its": [0, 1, 2, 4, 13, 16], "extens": [1, 2], "run": [0, 1, 2, 6, 8], "under": [1, 7, 8], "linux": [0, 1, 6], "shell": [0, 1, 3], "sourc": 1, "window": [0, 1, 6, 8], "For": [1, 6, 13], "gnu": 1, "core": 1, "util": [1, 3, 6, 7], "some": [1, 2, 3, 7, 8], "other": [1, 2, 3, 7, 8, 10, 11, 15], "implement": 1, "simpl": [1, 8], "command": [0, 1, 2, 3, 4, 6, 7, 8, 10, 11, 15], "ar": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15], "requir": [1, 6, 7, 8, 13, 14], "The": [0, 2, 3, 4, 6, 7, 8, 11, 13, 14], "ighv": [2, 9], "grch38": 2, "p12": 2, "ha": [2, 3, 4, 6, 9, 14], "been": [2, 3, 4, 6, 9], "thi": [0, 2, 3, 4, 6, 8, 9, 10, 11, 13, 14, 15], "exampl": [0, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16], "we": [2, 3, 6], "comparison": [2, 3, 7, 12], "reproduc": [2, 3], "us": [0, 2, 3, 4, 5, 6, 7, 8, 11, 12, 13, 14, 15, 16], "step": [2, 3], "below": [2, 3, 6, 8, 9], "repositori": [2, 3], "also": [2, 3, 8, 11, 14, 16], "directori": [0, 2, 3, 6, 7, 13, 14, 15], "pars": [2, 8, 16], "parse_imgt_annot": [2, 3, 7, 8, 11, 17], "save_sequ": [2, 3, 16], "imgt000035": 2, "fasta": [2, 3, 4, 8, 14, 15, 16], "http": [2, 3, 6, 7, 16], "www": [2, 3, 16], "org": [2, 3, 16], "ligmdb": [2, 3, 16], "view": [2, 3, 16], "format": [2, 3, 4, 5, 8, 10, 15, 16], "id": [2, 3, 4, 9, 13, 16], "imgt000035_gen": 2, "csv": [2, 3, 4, 10, 12, 13, 14, 15, 16], "creat": [2, 3, 11, 12, 14, 16], "two": [2, 3, 8], "contain": [0, 2, 3, 8, 9, 11, 13, 14, 15, 16], "sequenc": [2, 3, 4, 5, 7, 9, 10, 11, 12, 13, 14, 16], "co": [2, 7, 9, 16], "ordin": [2, 7, 9, 16], "gene": [2, 3, 4, 5, 7, 8, 9, 11, 13, 14, 15, 16], "flank": [2, 3, 8, 9], "region": [2, 3, 4, 7, 9, 13], "set": [2, 3, 6, 7, 8, 11, 13, 14, 15, 16], "from": [0, 2, 3, 4, 6, 8, 9, 11, 13, 14, 15], "receptor_util": [2, 3, 7], "extract_ref": [2, 3], "i": [0, 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15], "instal": [0, 2, 3, 5], "part": [2, 3, 9], "l": [2, 3, 7], "homo": 2, "sapien": 2, "homo_sapiens_ighv_gap": [2, 4], "homo_sapiens_ighv": [2, 4], "homo_sapiens_ighd": 2, "homo_sapiens_ighj": 2, "homo_sapiens_ch": 2, "lastli": 2, "need": [2, 3, 6, 14], "make": [2, 7], "combin": 2, "all": [2, 3, 5, 6, 8, 12], "v": [0, 2, 3, 4, 5, 9, 11, 13, 14, 15], "d": [2, 3, 5, 7, 9, 11, 14], "j": [2, 3, 5, 7, 9, 11, 14], "cat": [2, 3], "homo_sapiens_ighvdj": 2, "With": 2, "place": 2, "instruct": [2, 3, 6], "perform": [2, 8], "v_ref": [2, 14], "d_ref": [2, 14], "j_ref": [2, 14], "v_ref_gap": [2, 14], "ref": [2, 3, 7, 9, 15], "speci": [2, 3, 4, 8, 13, 14, 15], "provid": [2, 3, 4, 6, 8, 9, 13, 14, 15, 16], "germlin": [2, 3, 8, 14], "ani": [2, 7], "identifi": [2, 3, 4, 8, 12, 14, 15], "those": [2, 3, 7, 8], "It": [2, 3, 5, 8, 14, 16], "column": [2, 14], "nearest": 2, "ident": 2, "so": [2, 3, 4, 6, 7, 14], "These": [2, 3, 4, 6, 8, 11], "prefix": [2, 3, 9, 10], "specifi": [2, 3, 4, 7, 8, 9, 13, 14, 15, 16], "argument": [2, 3, 4, 9], "multipl": [2, 3, 4, 7, 8, 10, 14, 15], "pass": 2, "allow": [2, 4, 7, 14], "tell": 2, "intern": 2, "posit": [2, 7, 8, 9], "weight": [2, 8, 9, 14], "matric": [2, 8, 11, 14], "A": [2, 3, 4, 8], "sampl": 2, "copi": [2, 7, 11], "summaris": [2, 12], "progress": 2, "call": [2, 3, 7, 8], "follow": [0, 2, 3, 5, 6, 9, 11], "tool": [2, 3, 4, 8, 13], "makeblastdb": [2, 3, 6], "blast": [2, 3, 4, 6, 7, 8, 9, 10, 14, 15], "databas": [2, 3, 6], "blastn": [2, 3, 6], "against": [2, 3], "blastresults_to_csv": [2, 3, 8, 15, 17], "convert": [2, 3, 8, 10], "simpler": 2, "find_align": [2, 3, 7, 8, 9, 17], "align": [2, 3, 4, 7, 13, 14, 15], "compare_annot": [2, 3, 7, 8, 17], "summari": [2, 4, 8], "here": [2, 3], "forward": [2, 3, 12, 14, 15], "comparison_result": 2, "final": [2, 11], "should": [2, 6, 14, 15], "put": 2, "name": [2, 3, 7, 9], "three": [2, 8, 12], "produc": [2, 3, 8, 9, 11, 12, 13, 15], "differ": [2, 4, 7, 9, 12, 14], "graphic": 2, "jpg": [2, 12], "text": [2, 16], "list": [2, 3, 6, 8, 11, 12, 13, 14, 16], "function": [2, 3, 4, 5, 7, 11, 12, 14], "txt": [2, 12], "detail": [2, 4, 14], "line": [0, 2, 6, 8], "accord": 2, "an": [2, 3, 4, 7, 8, 12, 13, 14, 16], "addit": [2, 3, 5, 7, 9], "2": [2, 6, 9], "one": [2, 3, 8, 10, 12, 14, 16], "comparison_results_not": 2, "add": [2, 7], "commentari": 2, "unusu": 2, "variat": [2, 8], "rss": [2, 3, 5, 8, 9, 11, 12, 14], "caus": [2, 3, 7], "orf": [2, 5, 9], "ground": 2, "seen": 2, "rearrang": 2, "current": [0, 2, 3, 6], "although": 2, "tabl": [2, 3, 9], "There": [2, 8], "present": [2, 5, 13, 15], "clear": 2, "univers": 2, "accept": 2, "criteria": 2, "categoris": 2, "minor": [2, 7], "natur": 2, "expect": [2, 3, 8, 9, 11], "over": 2, "next": [2, 3], "few": 2, "year": [2, 14], "see": [2, 3, 6, 9], "genom": [2, 3, 8, 13], "express": 2, "repertoir": 2, "across": [2, 3], "subject": 2, "deeper": 2, "understand": [2, 3], "develop": [2, 6], "overal": [2, 3], "manual": 2, "supervis": 2, "curat": 2, "show": [2, 3, 8, 12], "good": [2, 8, 14], "level": 2, "agreement": [2, 12], "possibl": [2, 3, 4, 14], "mai": [2, 3, 6, 11, 14, 15], "chang": [2, 5], "note": [2, 3, 4, 5, 6, 9, 14], "thei": [2, 3, 4], "base": [2, 7, 8, 11], "revis": 2, "time": [2, 14, 15], "lefranc": 2, "et": [2, 3], "al": [2, 3], "2015": 2, "immunogenet": 2, "inform": [2, 4, 8, 13, 15], "system": [2, 3], "25": 2, "nucleic": 2, "acid": [2, 9, 11], "re": 2, "doi": [2, 3, 5], "10": [2, 3, 5, 6], "1093": [2, 5], "nar": 2, "gku1056": 2, "watson": 2, "2013": 2, "complet": [2, 14], "haplotyp": 2, "immunoglobulin": [2, 5, 8], "heavi": [2, 11], "chain": [2, 11], "variabl": [2, 6, 7], "divers": [2, 3], "join": 2, "character": 2, "allel": [2, 7, 13], "number": [2, 3, 4, 7, 8, 9, 11, 13, 14], "am": 2, "hum": 2, "genet": 2, "1016": 2, "ajhg": 2, "03": 2, "004": 2, "schneider": 2, "2017": 2, "evalu": [2, 3, 9, 14], "de": [2, 8, 15], "novo": [2, 8, 15], "haploid": 2, "demonstr": 2, "endur": 2, "qualiti": 2, "research": [2, 5], "1101": 2, "gr": 2, "213611": 2, "116": 2, "how": [3, 8], "exist": [3, 8, 10], "imgt": [3, 5, 7, 8, 9, 12, 14, 16], "underli": [3, 8], "might": 3, "when": [3, 7], "contig": [3, 7, 9, 14, 15], "scaffold": 3, "2006": 3, "mmul_051212": 3, "lie": 3, "within": [0, 3], "bring": 3, "them": 3, "togeth": 3, "singl": [3, 4, 8, 11], "motif": [3, 4, 7, 11, 13, 14, 15], "deriv": [3, 8], "rhemac10": 3, "mmul_10": 3, "while": [3, 6], "somewhat": 3, "artifici": 3, "could": [3, 7, 14], "equal": 3, "well": [3, 8], "handl": [3, 7], "individu": [3, 10, 11, 15], "approach": 6, "where": [3, 4, 7, 8], "process": [3, 14], "larg": [5, 13], "serv": 3, "packag": [3, 4, 6, 7, 8, 13, 14, 15], "flexibl": 3, "tune": 3, "search": [3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15], "illustr": 3, "work": [0, 3, 7, 14], "git": 3, "As": [3, 4], "previou": 3, "howev": [3, 8], "gap": [3, 4, 7, 9, 13, 14, 15], "insert": [3, 14], "codon": [3, 9, 11, 14], "rel": [3, 9], "convent": 3, "alongsid": 3, "further": [3, 14], "realign": 3, "fix_macaque_gap": 3, "macaca": 3, "mulatta": 3, "macaca_mulatta_ighv_gap": 3, "macaca_mulatta_ighv_gapped_fix": 3, "macaca_mulatta_ighv": 3, "macaca_mulatta_ighd": 3, "macaca_mulatta_ighj": 3, "macaca_mulatta_ighvdj": 3, "mmul_51212": 3, "nw_001157919": 3, "action": 3, "nw_001157919_gene": 3, "nw_001122023": 3, "nw_001122023_gene": 3, "nw_001122024": 3, "nw_001122024_gene": 3, "nw_001121239": 3, "nw_001121239_gene": 3, "nw_001121240": 3, "nw_001121240_gene": 3, "alreadi": [3, 8, 16], "pwm": [3, 8], "purpos": 3, "featur": [3, 5, 11, 16], "access": [3, 4, 8, 13], "imgt000064": [3, 16], "determin": [3, 8, 14], "calcul": 3, "mkdir": 3, "cd": [0, 3], "imgt000064_gen": 3, "calc_motif": [3, 8, 14, 17], "option": [3, 4, 13, 16], "conserved_motif": 3, "defin": 3, "strongli": 3, "conserv": [3, 8, 9, 14], "nucleotid": [3, 4, 9, 14], "leader": [3, 5, 8, 9, 11, 12, 14], "onli": [3, 4, 9, 11, 12, 15], "filenam": [3, 6], "were": [3, 7, 9, 10, 12], "figur": 3, "3": [3, 5, 6, 9, 11], "ngoun": 3, "2022": 3, "heptam": [3, 9], "cac": 3, "g": [3, 5, 7, 8, 9, 11, 16], "nonam": [3, 9], "aacc": 3, "5": [3, 9, 11], "gtg": 3, "t": [3, 5, 6], "c": [3, 4], "tgtg": 3, "gtt": 3, "tg": 3, "again": [3, 14], "locat": [3, 9, 14, 15], "top": 3, "presenc": [3, 15], "absenc": 3, "guid": [3, 4], "like": [3, 14], "pleas": [0, 3, 5, 6, 8, 10, 11, 12, 14, 15, 16], "bear": 3, "mind": 3, "except": 3, "particularli": 3, "definit": [3, 7, 9, 11], "have": [3, 8, 14], "built": [3, 8, 14], "limit": 3, "abl": [3, 6], "directli": [3, 4, 8], "start": [0, 3, 4, 7, 8, 9, 11, 14], "queri": [3, 7, 10], "dbtype": 3, "nucl": 3, "db": 3, "out": 3, "mmul_ighv": 3, "outfmt": 3, "7": [3, 4, 5, 10], "gapopen": 3, "gapextend": 3, "penalti": 3, "1": [3, 4, 6, 9], "word_siz": 3, "11": [3, 6], "mmul_ighd": 3, "100": [3, 4], "mmul_ighj": 3, "higher": 3, "quit": 3, "short": 3, "more": [3, 7, 8, 9, 10, 14], "conveni": [0, 3], "mmul_ighvdj_": 3, "merg": 3, "hit": [3, 14], "achiev": 3, "same": [3, 8], "append": [3, 10], "record": 3, "wa": [3, 7, 9], "per": 3, "modifi": [3, 6, 7, 11], "ensur": 3, "compat": [3, 7], "now": [3, 7], "mmul_ighvdj_nw_": 3, "motif_dir": [3, 13, 14, 15], "third": [3, 8], "wildcard": [3, 15], "match": [3, 4, 7, 8, 9, 12, 13, 14, 15], "quot": 3, "avoid": 3, "expans": 3, "templat": 3, "fix": [3, 7], "attempt": [3, 5, 15], "deduc": 3, "sens": [3, 4, 7, 9, 12, 14, 15], "segment": 3, "help": [0, 3, 6], "vari": 3, "orient": 3, "rather": [3, 4, 7], "than": [3, 4, 7], "would": [3, 14], "capabl": 3, "unfortun": 3, "split": [3, 10], "up": 3, "head": 3, "n": 3, "mmul_head": 3, "cp": 3, "nw_001157919_digger": 3, "grep": 3, "nw_001122023_digger": 3, "nw_001122024_digger": 3, "nw_001121239_digger": 3, "nw_001121240_digger": 3, "nw_001157919_comp": 3, "nw_001122023_comp": 3, "nw_001122024_comp": 3, "nw_001121239_comp": 3, "nw_001121240_comp": 3, "One": 9, "who": [], "report": 7, "r": [], "find": [6, 14, 15], "potenti": [3, 14], "thes": [], "li": [], "extrem": 3, "end": [3, 4, 7, 8, 9], "fulli": [], "repres": 13, "issu": 7, "total": 3, "13": 3, "four": 3, "five": 3, "ighd": 3, "known": 3, "occupi": 3, "small": [3, 5, 13], "distinct": 3, "toward": 3, "therefor": 3, "reason": [3, 8], "given": [3, 8, 11, 13, 15, 16], "technologi": 3, "avail": [0, 3, 4, 6, 8, 13], "length": [3, 4, 7, 8, 11], "correctli": [3, 7, 14], "assembl": 3, "anoth": [3, 8], "suspect": 3, "3nt": 3, "1nt": 3, "yet": 3, "appear": 3, "contrast": 3, "outsid": [3, 14], "biocur": 3, "monkei": 3, "vaccin": 3, "3390": 3, "vaccines10030394": 3, "warren": 3, "2020": 3, "analys": 3, "improv": [3, 7], "enhanc": 3, "Its": [3, 8], "biomed": 3, "scienc": 3, "1126": 3, "abc6617": 3, "gibb": 3, "2007": 3, "evolutionari": 3, "insight": 3, "1139247": 3, "far": 4, "mani": [4, 14], "receptor": [4, 6, 7, 8, 13], "wide": 4, "rang": 4, "companion": 4, "dig_sequ": [4, 7, 8, 17], "closest": [4, 7, 8, 9, 14], "onlin": 4, "ighv1": 4, "18": 4, "04": 4, "genbank": [4, 7, 8, 13], "kc713938": 4, "01": 4, "user": [4, 6, 7], "william": 4, "miniconda3": 4, "env": 4, "digby_genomics310": 4, "lib": 4, "site": 4, "igh": [4, 5, 8, 10, 11, 12, 14, 15, 16], "target_allel": 4, "genbank_acc": [4, 13], "genbank_seq": 4, "935nt": 4, "gene_seq": 4, "atggactggacctggagcatccttttcttggtggcagcagcaacaggtaacggactccccagtcccagggctgagagagaaaccaggccagtcatgtgagacttcacccactcctgtgtcctctccacaggtgcccactcccaggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacacagtgtgaaaacccacatcctgagggtttcagaaacc": 4, "seq": [4, 9], "caggttcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga": 4, "alignment_scor": 4, "99": 4, "nt_diff": [4, 7], "snp": 4, "_t111c": 4, "392": 4, "687": 4, "l_part1": [4, 9], "atggactggacctggagcatccttttcttggtggcagcagcaacag": 4, "l_part2": [4, 9], "gtgcccactcc": 4, "v_heptam": [4, 9], "cacagtg": 4, "v_nonam": [4, 9], "tcagaaacc": 4, "take": [4, 15], "includ": [4, 6, 7, 9, 11, 12, 14], "otherwis": [4, 15], "assum": 4, "refer": [4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16], "If": [4, 5, 6, 9, 10, 14], "output": [4, 10, 12, 13, 14, 15, 16], "out_fil": [4, 13], "written": 4, "standard": 4, "sequenec": 4, "return": 4, "regulatori": 4, "variant": 4, "toolkit": [5, 8], "automat": [5, 6, 14, 15], "unrearrang": 5, "b": 5, "cell": 5, "both": [5, 8, 12, 14], "entir": [5, 9, 13], "fragment": 5, "locu": [5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16], "e": [5, 7, 8, 9, 11, 16], "exclud": 5, "utr": [5, 7], "classifi": 5, "pseudogen": [5, 9], "practc": 5, "overview": 5, "dig": 5, "releas": 5, "target": [5, 7, 8, 12, 13], "commandlin": 5, "anot": 5, "index": 5, "modul": 5, "page": [5, 6, 9], "latest": [0, 6], "stabl": 6, "version": [0, 6], "pypi": 6, "python": [6, 11], "9": 6, "abov": [6, 9], "No": 6, "just": [6, 13, 14], "execut": 6, "onc": 6, "verifi": [6, 8], "type": [6, 9], "everyth": 6, "ok": 6, "usag": [6, 10, 11, 12, 13, 14, 15, 16], "you": [0, 5, 6, 8, 14], "encount": 6, "error": [6, 7], "cannot": 6, "alloc": 6, "memori": 6, "come": [6, 14], "environ": 6, "blastdb_lmdb_map_s": 6, "100000000": 6, "easiest": 6, "wai": 6, "itself": [6, 8], "pip": 6, "biopython": 6, "support": [6, 7], "move": 7, "trp": 7, "suppli": [7, 14], "email": [7, 13], "address": [7, 13], "request": [7, 13], "bump": 7, "ad": 7, "tra": [7, 11, 12, 16], "trb": [7, 16], "trd": [7, 12, 16], "trg": [7, 16], "tr": [7, 8], "unintend": 7, "breakpoint": 7, "fire": 7, "circumst": 7, "erron": 7, "leader1": 7, "variou": 7, "effect": 7, "lead": 7, "neg": 7, "coordin": 7, "annot": [7, 8, 10, 11, 12, 13, 14, 15, 16], "properli": 7, "url": [7, 16], "longer": 7, "utilis": 7, "nt": [7, 11], "between": [7, 8, 11], "updat": 7, "code": [7, 8, 9, 13], "bio": 7, "pairwise2": 7, "deprec": 7, "40": 7, "speed": 7, "optimis": 7, "without": 7, "paramet": [3, 7, 11], "non": 7, "revers": [7, 9, 12, 14, 15], "fals": [7, 10, 12, 13, 14, 15], "being": 7, "filter": [7, 12], "store": [7, 14, 16], "local": 7, "specif": [3, 6, 7, 8, 12], "refactor": 7, "element": 7, "modular": 7, "easier": 7, "maintain": 7, "first": [7, 8, 9], "public": 7, "princip": 8, "similar": [6, 8, 14], "most": [8, 9], "determinng": [], "full": [8, 14], "discov": [8, 14], "slower": 8, "assembli": [7, 8, 14, 15, 16], "input": [8, 9], "point": [8, 14], "studi": 8, "ideal": 8, "obtain": [6, 8], "prefer": 8, "close": 8, "relat": 8, "intend": 8, "straightforward": 8, "familiar": 8, "approxim": 8, "extend": [8, 14], "either": [8, 12, 14], "check": [8, 15], "mean": [8, 9], "establish": 8, "canon": [8, 14], "form": 8, "observ": 8, "tailor": 8, "interest": 8, "initi": [8, 14], "": [6, 7, 8, 9, 12, 14], "select": [8, 14, 15], "brief": 8, "subsidiari": 8, "section": 8, "explain": 8, "second": [8, 9], "gener": 8, "mode": 8, "describ": [0, 8, 9, 13], "descript": 8, "tabular": 8, "compar": [8, 9, 12, 14, 15], "tabul": 8, "ord": 9, "start_rev": 9, "prime": 9, "end_rev": 9, "gene_typ": 9, "gene_start": 9, "gene_end": 9, "likelihood": 9, "random": 9, "equenc": 9, "j_heptam": 9, "j_nonam": 9, "j_frame": 9, "frame": 9, "0": [5, 6, 9, 11], "d_3_heptam": 9, "d_3_nonam": 9, "d_5_heptam": 9, "d_5_nonam": 9, "aa": 9, "amino": [9, 11], "translat": 9, "gene_aligned_aa": 9, "seq_gap": 9, "5_rss_start": 9, "5_rss_start_rev": 9, "5_rss_end": 9, "5_rss_end_rev": 9, "3_rss_start": 9, "3_rss_start_rev": 9, "3_rss_end": 9, "3_rss_end_rev": 9, "l_part1_start": 9, "l_part1_start_rev": 9, "l_part1_end": 9, "l_part1_end_rev": 9, "l_part2_start": 9, "l_part2_start_rev": 9, "l_part2_end": 9, "l_part2_end_rev": 9, "blast_match": 9, "highest": [9, 14], "score": 9, "blast_scor": 9, "blast_nt_diff": 9, "highli": 9, "_match": 9, "_score": 9, "_nt_diff": 9, "assign": 9, "meet": 9, "exce": 9, "matrix": 9, "threshold": 9, "agre": 9, "atg": 9, "splice": [9, 11], "stop": 9, "befor": [9, 11], "cystein": 9, "104": 9, "donor": 9, "condit": 9, "met": 9, "detect": 9, "pseudo": 9, "doe": 9, "separ": [10, 14, 15], "h": [10, 11, 12, 13, 14, 15, 16], "infil": 10, "out_prefix": 10, "default": [7, 10, 12, 13, 14, 15], "field": 11, "mark": 11, "consid": [11, 12], "valu": 11, "j_trp_motif": 11, "fgxg": 11, "wgxg": 11, "j_trp_offset": 11, "j_splice": 11, "v_rss_space": 11, "spacer": 11, "j_rss_space": 11, "d_5_rss_space": 11, "d_3_rss_space": 11, "feat_fil": 11, "parse_annot": 12, "venn": 12, "diagram": 12, "oppos": 12, "mmethod": 12, "nc": 12, "filter_annot": 12, "comp_nam": 12, "target_locu": 12, "digger_result": 12, "annotation_fil": 12, "outfil": [12, 16], "parse_imgt_assembly_x": 12, "py": [7, 12, 15], "best": 13, "fetch": 13, "must": [13, 14], "api": 13, "nomin": 13, "debug": [13, 15], "germline_fil": [13, 15], "query_fil": 13, "ungap": [13, 14, 15], "probabl": [13, 14, 15], "parsing_error": [13, 15], "email_addr": 13, "read": [13, 14, 15], "correspond": [13, 14], "associ": 13, "former": 14, "nonfunct": 14, "ref_comp": [7, 14], "keepwf": 14, "assembly_fil": [14, 15], "output_fil": [14, 15], "pathnam": 14, "novel": [7, 14], "comma": [14, 15], "eg": [14, 15], "mous": [14, 15], "repeat": [14, 15], "omit": 14, "keep": 14, "after": 14, "At": 14, "least": 14, "whatev": 14, "practic": 14, "do": [6, 14], "partial": 14, "logic": 14, "postion": 14, "rhesus_macaqu": 14, "conjunct": 14, "correct": 14, "altern": [6, 14], "custom": 14, "gep": 14, "order": 14, "extran": 14, "particular": 14, "introduc": 14, "recent": 14, "wish": 14, "proxim": 14, "choos": 14, "elicit": 14, "shown": 14, "decid": 14, "whether": 14, "made": 14, "right": 14, "choic": 14, "valid": 15, "blast_fil": 15, "glob": 15, "build": 16, "save_download": 16, "save_imgt_annot": 16, "imgt_url": 16, "content": 16, "igk": 16, "igl": 16, "save": 16, "addition": 3, "motif_param": 3, "json": 3, "descrb": 3, "bk063799": 2, "crash": 7, "miss": 7, "docker": [5, 7], "imag": [5, 7], "depend": [0, 7], "document": [0, 7], "hub": 0, "williamle": 0, "pull": 0, "To": 0, "mac": [0, 6], "pwd": 0, "scratch": 0, "bash": 0, "Or": 0, "prompt": 0, "mount": 0, "conda": 6, "anaconda": 6, "recommend": 6, "bioconda": 6, "link": 6, "better": 7, "explan": 7, "load": 6, "share": 6, "librari": 6, "libnsl": 6, "precis": 6, "platform": 6, "guidanc": 6, "through": 6, "googl": 6, "ncbi": 6, "ask": 6, "brows": 6, "ftp": 6, "nlm": 6, "nih": 6, "gov": 6, "browser": 6, "ceas": 6, "your": [5, 6], "won": 6, "open": 6, "curl": 6, "12": 6, "win64": 6, "ex": 6, "o": 6, "reflect": 6, "On": 6, "new": 6, "part1": 7, "part2": 7, "identif": 7, "tata_box": 7, "octam": 7, "promot": 7, "dockeris": 7, "makedb": 7, "cite": 5, "paper": 5, "direct": 5, "bioinformat": 5, "2024": 5, "btae144": 5, "problem": 7, "salmonid": 7, "trb3v": 7}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"addit": 1, "exampl": [1, 5], "annot": [2, 3, 4, 5, 9], "human": 2, "igh": [2, 3], "locu": [2, 3], "data": [2, 3], "assembli": [2, 3, 5], "compar": [2, 3], "output": [2, 3], "imgt": 2, "": [2, 3], "refer": [2, 3], "rhesu": 3, "macaqu": 3, "prepar": 3, "posit": [3, 10, 11, 12, 13, 14, 15, 16], "weight": 3, "matric": 3, "studi": 3, "target": 4, "digger": [5, 8, 14], "tool": 5, "genom": 5, "ig": 5, "tr": 5, "receptor": 5, "loci": 5, "get": 5, "start": 5, "usag": [5, 17], "document": 5, "indic": 5, "tabl": 5, "instal": 6, "releas": 7, "note": 7, "chang": 7, "0": 7, "6": 7, "3": 7, "2": 7, "1": 7, "v": 7, "5": 7, "10": 7, "9": 7, "8": 7, "7": 7, "4": 7, "version": 7, "april": 7, "2023": 7, "overview": 8, "scope": 8, "featur": 8, "pipelin": 8, "dig": 8, "sequenc": 8, "anot": 9, "format": 9, "column": 9, "file": 9, "function": 9, "blastresults_to_csv": 10, "argument": [10, 11, 12, 13, 14, 15, 16], "name": [10, 12, 13, 14, 15, 16], "calc_motif": 11, "compare_annot": 12, "dig_sequ": 13, "sub": 13, "command": 13, "fasta": 13, "singl": 13, "multi": 13, "multi_seq": 13, "find_align": 15, "parse_imgt_annot": 16, "commandlin": 17, "docker": 0, "imag": 0, "citat": 5}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 8, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.viewcode": 1, "sphinx": 57}, "alltitles": {"Docker Image": [[0, "docker-image"]], "Additional Examples": [[1, "additional-examples"]], "Annotating the human IGH locus": [[2, "annotating-the-human-igh-locus"]], "Data": [[2, "data"], [3, "data"]], "Annotating the Assembly": [[2, "annotating-the-assembly"], [3, "annotating-the-assembly"]], "Comparing the output to IMGT\u2019s annotation": [[2, "comparing-the-output-to-imgt-s-annotation"]], "References": [[2, "references"], [3, "references"]], "Annotating the rhesus macaque IGH locus": [[3, "annotating-the-rhesus-macaque-igh-locus"]], "Preparing position-weighted matrices": [[3, "preparing-position-weighted-matrices"]], "Comparing the output to the study\u2019s annotation": [[3, "comparing-the-output-to-the-study-s-annotation"]], "Targeted Annotation": [[4, "targeted-annotation"]], "Installation": [[6, "installation"]], "Overview": [[8, "overview"]], "digger": [[8, "digger"], [14, "digger"]], "Scope and Features": [[8, "scope-and-features"]], "Pipeline": [[8, "pipeline"]], "dig-sequence": [[8, "dig-sequence"]], "Anotation format": [[9, "anotation-format"]], "Columns in the Annotation File": [[9, "columns-in-the-annotation-file"]], "Functionality": [[9, "functionality"]], "blastresults_to_csv": [[10, "blastresults-to-csv"]], "Positional Arguments": [[10, "positional-arguments"], [11, "positional-arguments"], [12, "positional-arguments"], [13, "positional-arguments"], [13, "positional-arguments_repeat1"], [13, "positional-arguments_repeat2"], [13, "positional-arguments_repeat3"], [15, "positional-arguments"], [16, "positional-arguments"], [14, "positional-arguments"]], "Named Arguments": [[10, "named-arguments"], [12, "named-arguments"], [13, "named-arguments"], [13, "named-arguments_repeat1"], [13, "named-arguments_repeat2"], [13, "named-arguments_repeat3"], [15, "named-arguments"], [16, "named-arguments"], [14, "named-arguments"]], "calc_motifs": [[11, "calc-motifs"]], "compare_annotations": [[12, "compare-annotations"]], "dig_sequence": [[13, "dig-sequence"]], "Sub-commands": [[13, "Sub-commands"]], "fasta": [[13, "fasta"]], "single": [[13, "single"]], "multi": [[13, "multi"]], "multi_seq": [[13, "multi_seq"]], "find_alignments": [[15, "find-alignments"]], "parse_imgt_annotations": [[16, "parse-imgt-annotations"]], "Commandline Usage": [[17, "commandline-usage"]], "Digger: tools for annotating genomic assemblies of the IG/TR receptor loci": [[5, "digger-tools-for-annotating-genomic-assemblies-of-the-ig-tr-receptor-loci"]], "Getting Started": [[5, null]], "Examples": [[5, null]], "Usage Documentation": [[5, null]], "Indices and tables": [[5, "indices-and-tables"]], "Citation": [[5, "citation"]], "Release Notes": [[7, "release-notes"]], "Changes in 0.7.3": [[7, "changes-in-0-7-3"], [7, "id1"]], "Changes in 0.7.2": [[7, "changes-in-0-7-2"]], "Changes in 0.7.1": [[7, "changes-in-0-7-1"]], "Changes in 0.7.0": [[7, "changes-in-0-7-0"]], "Changes in 0.6.9": [[7, "changes-in-0-6-9"]], "Changes in 0.6.8": [[7, "changes-in-0-6-8"]], "Changes in 0.6.7": [[7, "changes-in-0-6-7"], [7, "id2"]], "Changes in 0.6.6": [[7, "changes-in-0-6-6"]], "Changes in 0.6.4": [[7, "changes-in-0-6-4"]], "Changes in 0.6.3:": [[7, "changes-in-0-6-3"]], "Changes in 0.6.2:": [[7, "changes-in-0-6-2"]], "Changes in 0.6.1:": [[7, "changes-in-0-6-1"]], "Changes in 0.6.0:": [[7, "changes-in-0-6-0"]], "Changes in v 0.5.10:": [[7, "changes-in-v-0-5-10"]], "Changes in v 0.5.9:": [[7, "changes-in-v-0-5-9"]], "Changes in v 0.5.8:": [[7, "changes-in-v-0-5-8"]], "Changes in v 0.5.7:": [[7, "changes-in-v-0-5-7"]], "Changes in v 0.5.6:": [[7, "changes-in-v-0-5-6"]], "Changes in v 0.5.5:": [[7, "changes-in-v-0-5-5"]], "Changes in V 0.5.4:": [[7, "changes-in-v-0-5-4"]], "Changes in V 0.5.3:": [[7, "changes-in-v-0-5-3"]], "Changes in V 0.5.2:": [[7, "changes-in-v-0-5-2"]], "Changes in V 0.5.1:": [[7, "changes-in-v-0-5-1"]], "Version 0.5: April 2023": [[7, "version-0-5-april-2023"]]}, "indexentries": {}}) \ No newline at end of file diff --git a/docs/index.rst b/docs/index.rst index 0d80a8e..46359a5 100644 --- a/docs/index.rst +++ b/docs/index.rst @@ -40,3 +40,9 @@ Indices and tables * :ref:`genindex` * :ref:`modindex` * :ref:`search` + +Citation +======== +If you use Digger in your research, please cite the following paper: +Digger: directed annotation of immunoglobulin and T cell receptor V, D and J gene sequences and assemblies. +Bioinformatics, 2024. `DOI: 10.1093/bioinformatics/btae144 `_. diff --git a/src/receptor_digger.egg-info/PKG-INFO b/src/receptor_digger.egg-info/PKG-INFO index 9d4f5b2..b6e9101 100644 --- a/src/receptor_digger.egg-info/PKG-INFO +++ b/src/receptor_digger.egg-info/PKG-INFO @@ -1,6 +1,6 @@ Metadata-Version: 2.1 Name: receptor_digger -Version: 0.7.3 +Version: 0.7.4 Summary: Tools for de novo discovery of genomic germline IG and TR receptor sequences Home-page: https://github.com/williamdlees/digger Author: William Lees