Skip to content

Latest commit

 

History

History
108 lines (72 loc) · 3.57 KB

README.md

File metadata and controls

108 lines (72 loc) · 3.57 KB
Raw

NCBIBlast

Build Status Coverage

This package is a thin wrapper around the Basic Local Alignment Search Tool CLI, better known as BLAST, developed by the National Center for Biotechnology Information (NCBI).

For now, this uses CondaPkg.jl to install BLAST+.

Usage

This package provides a thin-wrapper around the BLAST+ command line tools:

  • blastn
  • blastp
  • tblastn
  • blastx
  • makeblastdb

For each tool is controlled by keyword arguments, which are generally passed as -key value, unless value is true, in which case it is passed as -key.

For example, the julia call

blastn(; query = "a_file.txt", db="mydb", out="results.txt")

Will be sent to the shell as

$ blastn -query a_file.txt -db mydb -out results.txt

For all but makeblastdb, you can also pass a positional argument that will be piped as STDIN, and the special keyword argument stdout where results will be passed instead of being printed to the screen. The stdout kwarg can be a String representing a path, in which case a file will be created, or a julia IO type, in which case the results will be written to that object.

For example, to replicate the shell command

$ blastn -remote -outfmt "6 query subject expect" -db nr < myfile.fastn > output.tsv

You can do

blastn("myfile.fastn"; stdout="output.tsv", remote=true, outfmt="6 query subject expect", db="nr")

Examples

julia> makeblastdb(; in="test/example_files/dna2.fasta", dbtype="nucl")


Building a new DB, current time: 10/07/2024 16:59:40
New DB name:   /home/kevin/Repos/NCBIBlast.jl/test/example_files/dna2.fasta
New DB title:  test/example_files/dna2.fasta
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 3000000000B
Adding sequences from FASTA; added 2 sequences in 0.00329995 seconds.


Process(`makeblastdb -in test/example_files/dna2.fasta -dbtype nucl`, ProcessExited(0))

julia> buf = IOBuffer("TTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAG")
IOBuffer(data=UInt8[...], readable=true, writable=false, seekable=true, append=false, size=38, maxsize=Inf, ptr=1, mark=-1)

julia> blastn(buf; db="test/example_files/dna2.fasta", outfmt="6")
Query_1 Test1   100.000 38      0       0       1       38      82      119     5.64e-18        71.3
Process(`blastn -db test/example_files/dna2.fasta -outfmt 6`, ProcessExited(0))

julia> using CSV, DataFrames

julia> io = IOBuffer();

julia> blastn(buf; stdout=io, db="test/example_files/dna2.fasta", outfmt="6");

julia> seek(io, 0);

julia> CSV.read(io, DataFrame; header=false)
1×12 DataFrame
 Row │ Column1  Column2  Column3  Column4  Column5  Column6  Column7  Column8  Column9  Column10  Column11  Column12
     │ String7  String7  Float64  Int64    Int64    Int64    Int64    Int64    Int64    Int64     Float64   Float64
─────┼───────────────────────────────────────────────────────────────────────────────────────────────────────────────
   1 │ Query_1  Test1      100.0       38        0        0        1       38       82       119  5.64e-18      71.3