local installation of module: tantan

modules.json

@@ -19,6 +19,20 @@
                             "modules"
                         ]
                     },
+                    "repeatmodeler/builddatabase": {
+                        "branch": "master",
+                        "git_sha": "1cbb5551b917aa423e414dcd69898d01520a309d",
+                        "installed_by": [
+                            "modules"
+                        ]
+                    },
+                    "repeatmodeler/repeatmodeler": {
+                        "branch": "master",
+                        "git_sha": "84efd2f87d07deb22ee9378f065a9aa5f1434161",
+                        "installed_by": [
+                            "modules"
+                        ]
+                    },
                     "windowmasker/mkcounts": {
                         "branch": "master",
                         "git_sha": "32cac29d4a92220965dace68a1fb0bb2e3547cac",

modules/local/tantan.nf

@@ -0,0 +1,85 @@
+// TODO nf-core: If in doubt look at other nf-core/modules to see how we are doing things! :)
+//               https://github.com/nf-core/modules/tree/master/modules/nf-core/
+//               You can also ask for help via your pull request or on the #modules channel on the nf-core Slack workspace:
+//               https://nf-co.re/join
+// TODO nf-core: A module file SHOULD only define input and output files as command-line parameters.
+//               All other parameters MUST be provided using the "task.ext" directive, see here:
+//               https://www.nextflow.io/docs/latest/process.html#ext
+//               where "task.ext" is a string.
+//               Any parameters that need to be evaluated in the context of a particular sample
+//               e.g. single-end/paired-end data MUST also be defined and evaluated appropriately.
+// TODO nf-core: Software that can be piped together SHOULD be added to separate module files
+//               unless there is a run-time, storage advantage in implementing in this way
+//               e.g. it's ok to have a single module for bwa to output BAM instead of SAM:
+//                 bwa mem | samtools view -B -T ref.fasta
+// TODO nf-core: Optional inputs are not currently supported by Nextflow. However, using an empty
+//               list (`[]`) instead of a file can be used to work around this issue.
+
+process TANTAN {
+    tag "$meta.id"
+    label 'process_low'
+
+    // TODO nf-core: List required Conda package(s).
+    //               Software MUST be pinned to channel (i.e. "bioconda"), version (i.e. "1.10").
+    //               For Conda, the build (i.e. "h9402c20_2") must be EXCLUDED to support installation on different operating systems.
+    // TODO nf-core: See section in main README for further information regarding finding and adding container addresses to the section below.
+    conda "${moduleDir}/environment.yml"
+    container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+        'https://depot.galaxyproject.org/singularity/tantan:49--h43eeafb_0':
+        'biocontainers/tantan:49--h43eeafb_0' }"
+
+    input:
+    // TODO nf-core: Where applicable all sample-specific information e.g. "id", "single_end", "read_group"
+    //               MUST be provided as an input via a Groovy Map called "meta".
+    //               This information may not be required in some instances e.g. indexing reference genome files:
+    //               https://github.com/nf-core/modules/blob/master/modules/nf-core/bwa/index/main.nf
+    // TODO nf-core: Where applicable please provide/convert compressed files as input/output
+    //               e.g. "*.fastq.gz" and NOT "*.fastq", "*.bam" and NOT "*.sam" etc.
+    tuple val(meta), path(ref)
+
+    output:
+    // TODO nf-core: Named file extensions MUST be emitted for ALL output channels
+    tuple val(meta), path("*.masked.fa"), emit: masked_fasta
+    // TODO nf-core: List additional required output channels/values here
+    path "versions.yml"           , emit: versions
+
+    when:
+    task.ext.when == null || task.ext.when
+
+    script:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    // TODO nf-core: Where possible, a command MUST be provided to obtain the version number of the software e.g. 1.10
+    //               If the software is unable to output a version number on the command-line then it can be manually specified
+    //               e.g. https://github.com/nf-core/modules/blob/master/modules/nf-core/homer/annotatepeaks/main.nf
+    //               Each software used MUST provide the software name and version number in the YAML version file (versions.yml)
+    // TODO nf-core: It MUST be possible to pass additional parameters to the tool as a command-line string via the "task.ext.args" directive
+    // TODO nf-core: If the tool supports multi-threading then you MUST provide the appropriate parameter
+    //               using the Nextflow "task" variable e.g. "--threads $task.cpus"
+    // TODO nf-core: Please replace the example samtools command below with your module's command
+    // TODO nf-core: Please indent the command appropriately (4 spaces!!) to help with readability ;)
+    """
+    tantan ${ref} > ${prefix}.masked.fa
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        tantan: \$(tantan --version |& sed '1!d ; s/tantan //')
+    END_VERSIONS
+    """
+
+    stub:
+    def args = task.ext.args ?: ''
+    def prefix = task.ext.prefix ?: "${meta.id}"
+    // TODO nf-core: A stub section should mimic the execution of the original module as best as possible
+    //               Have a look at the following examples:
+    //               Simple example: https://github.com/nf-core/modules/blob/818474a292b4860ae8ff88e149fbcda68814114d/modules/nf-core/bcftools/annotate/main.nf#L47-L63
+    //               Complex example: https://github.com/nf-core/modules/blob/818474a292b4860ae8ff88e149fbcda68814114d/modules/nf-core/bedtools/split/main.nf#L38-L54
+    """
+    touch ${prefix}.masked.fa
+
+    cat <<-END_VERSIONS > versions.yml
+    "${task.process}":
+        tantan: \$(tantan --version |& sed '1!d ; s/tantan //')
+    END_VERSIONS
+    """
+}

sample.csv

@@ -0,0 +1,2 @@
+sample,fasta
+t1,./sample.fa

sample.fa

@@ -0,0 +1 @@
+ATCGATCGATCGATCGATCGATCGATCGATCG

workflows/pairgenomealignmask.nf

@@ -6,6 +6,7 @@
 
 include { WINDOWMASKER_USTAT     } from '../modules/nf-core/windowmasker/ustat/main'
 include { WINDOWMASKER_MKCOUNTS  } from '../modules/nf-core/windowmasker/mkcounts/main'
+include { TANTAN                 } from '../modules/local/tantan.nf'
 include { MULTIQC                } from '../modules/nf-core/multiqc/main'
 include { paramsSummaryMap       } from 'plugin/nf-validation'
 include { paramsSummaryMultiqc   } from '../subworkflows/nf-core/utils_nfcore_pipeline'
@@ -28,6 +29,13 @@ workflow PAIRGENOMEALIGNMASK {
     ch_versions = Channel.empty()
     ch_multiqc_files = Channel.empty()
 
+    //
+    // MODULE: TANTAN
+    //
+    TANTAN (
+        ch_samplesheet
+    )
+
     //
     // MODULE: WINDOWMASKER_MKCOUNTS
     //