Some QUIck Reconstruction to Resolve Evolutionary Links
Why use squirrel?
The MPXV genome is pretty challenging to work with and do reliable phylogenetics on. It is large (~200kb), has tracts of low complexity and repetitive regions, and has large deletions, which can lead to difficulties producing a reliable alignment. With squirrel, we provide a rapid way of producing reliable alignments for MPXV and also enable maximum-likelihood phylogenetics pipeline tree estimation.
The reliability of tree estimation is determined by the quality of the input genome sequences. In QC mode, squirrel can flag potential issues in the MPXV sequences that have been provided for alignment (e.g. SNPS near tracts of N, clusters of unique SNPs, reversions to reference alleles and convergent mutations) and outputs these in a mask file for investigation. We suggest you use this information to examine the alignment and pay close attention to the regions flagged. Squirrel can then accept this file with suggested masks and apply it to the sequences before doing phylogenetics.
Enrichment of APOBEC3-mutations in the MPXV population are a signature of sustained human-to-human transmission. Identifying APOBEC3-like mutations in MPXV genomes from samples in a new outbreak can be a piece of evidence to support sustained human transmission of mpox. Squirrel can run an APOBEC3-reconstruction and map these mutations onto the phylogeny.
Squirrel produces a HTML report summarising some of the key outputs.
To align MPXV Clade II sequences, run:
squirrel <your-sequences.fasta>
To align MPXV Clade I sequences, run:
squirrel --clade cladei <your-sequences.fasta>
where <your-sequences.fasta>
is the name of your input FASTA sequence file. Click here see what a FASTA formatted file looks like.
Note, an EPI2ME wrapper for squirrel with the same options is available here.
Squirrel maps each query genome in the input file against a reference genome specific to each clade using minimap2. Using gofasta, the mapping file is then converted into a multiple sequence alignment.
For Clade II, the reference used is NC_063383
and for Clade I, we use NC_003310
. This means that all coordinates within an alignment will be relative to these references. A benefit of this is that within a clade, alignment files and be combined without having to recalculate the alignment. Note however that insertions relative to the reference sequence will not be included in the alignment.
Squirrel by default creates a single alignment fasta file. Using the genbank coordinates for NC_063383
it also has the ability to extract the aligned coding sequences either as separate records or as a concatenated alignment. This can facilitate codon-aware phylogenetic or sequence analysis.
The final alignment from squirrel has additional processing steps that includes various masking options. By default, squirrel trims the alignment to 190788 at the end of the genome to mask out one of the inverted terminal repeat (ITR) regions and pads the end of the genome with N
. This can be disabled with the --no-itr-mask
flag.
Squirrel performs masking (replacement with N
) on low-complexity or repetitive regions that have been characterised for Clade I and II. These regions are defined in to_mask.cladeii.csv and to_mask.cladei.csv respectively, and the relevant mask file will be selected depending on the --clade
specified. This masking is on by default but can be toggled off (with --no-mask
).
Squirrel can also accept an additional mask file in csv format (--additional-mask
), if there are flagged sites that you wish to mask within the alignment. These sites will be masked in conjuntion with the default masking files within squirrel. The format of the mask file fits with the features format from Geneious and at a minimum should contain the following fields: "Maximum","Minimum". If squirrel is run in QC mode (-qc
on the command like to toggle it on), it will flag sites that it believes may need to be masked from the alignment and produce a csv mask file summarising the sites. This file can then be provided to squirrel to redo the alignment with additional masking.
Squirrel now offers a sequence-specific mask option for making particular sites in a problematic sequence, rather than masking out the entire column across the alignment. This can be achieved with --sequence-mask
and requires the user to supply a csv file with a sequence
column that contains the sequence name (must match an id in the supplied FASTA file) and a site
column, with a 1-based position to mask. If a sequence needs multiple sites masked, specify them on separate lines in the file with the same sequence name.
Squirrel can run quality control (QC) on the alignment and flag certain sites to the user that may need to be masked. We recommend that the user looks at these sites in an alignment viewer to judge whether the sites should be masked or not. If -qc
mode is toggled on, squirrel with check within the alignment for:
- Mutations that are adjacent to N bases The rationale for this is that N sites are usually a product of low coverage regions. Mutations that occur directly adjacent to low coverage regions may be a result of mis-alignment prior to the low coverage masking and may not be real SNPs. In squirrel, non-majority alleles that are present next to an N are flagged as potential sites for masking.
- Unique mutations that clump together If mutations are observed in only a single sequence in the genome, they are classed as unique mutations. Usually mutations do not clump closely together and may suggest an alignment or assembly issue. If these mutations are not shared with any other sequences, they are flagged for masking.
- Sequences with a high N content Sequences that have many ambiguous bases in them are flagged that they may want to be excluded in further analysis. This may not always be appropriate, often genomes that have a lot of ambiguity can still be informative, however if there is something unusual about a sequence, having lots of ambiguities can be a flag for wider problems (like low read count during assembly).
To build a maximum-likelihood phylogeny with IQTREE2 with the alignment generated, run the following:
squirrel <your-sequences.fasta> --run-phylo --outgroups outgroup_id1,outgroup_id2
If you wish to include a background set of sequences and not have to specify an outgroup, run the following:
squirrel <your-sequences.fasta> --run-phylo --include-background
More details on --include-background
can be found here.
Signatures of APOBEC3-editing are characteristic of MPXV evolution when sustained transmission in the human population (see O'Toole et al 2023). To also run the maximum-likelihood phylogenetics and ancestral reconstruction pipeline that characterises the APOBEC3-like and non-APOBEC3 mutations that have occurred across the evolutionary history of the virus sequences provided, run the following:
squirrel <your-sequences.fasta> --run-apobec3-phylo --outgroups outgroup_id1,outgroup_id2
Note: the sequence file you provide must have the specified outgroups in it, with the IDs matching those you provide. This pipeline can accept one or more outgroup IDs. The outgroups help to root the phylogeny so that ancestral reconstruction can be performed in the appropriate direction.
-
Clade I KJ642617,KJ642615
-
Clade IIb KJ642617,KJ642615
So as an example, to run phylogenetics mode on a Clade I dataset, include KJ642617, KJ642615 and KJ642616 in your test sequence file and run:
squirrel --clade cladei --run-phylo --outgroups KJ642617,KJ642615 ./test/cladeI_test.fasta
Squirrel has the optional --run-phylo
and --run-apobec3-phylo
modes that will take the newly generated alignment and build a maximum likelihood phylogeny using IQTREE2. With --run-apobec3-phylo
mode, it also runs IQTREE ancestral state reconstruction (-asr
), and parses the output state files, providing a branch-mapped summary of SNPs that have occurred across the phylogeny, and an output phylogeny figure with SNPs plotted along branches, coloured by whether SNPs are consistent with APOBEC3-editing or not. An outgroup (or multiple outgroups) must be specified (although this is handled internally in --include-background
mode) to ensure correct rooting for the ancestral state reconstruction. If --cns-qc
mode is on in conjunction with phylogenetics, reversions to reference and convergent SNPs are also flagged using the reconstruction.
The squirrel software has a set of publically available MPXV genome sequences that include representatives of CladeIa, CladeIb, Clade IIa and CladeIIb. The sequences, the Genbank accession numbers and their clade annotations can be found in background_sample.csv and background.fasta.
If --include-background
is run with the squirrel command, squirrel will automatically pull out the background sequences from the relevant clade and select the appropriate outgroup from the background set.
For example, if squirrel --clade cladei --include-background <sequences.fasta>
is run, squirrel will combine all Clade I background sequences with the input <sequences.fasta>
file and also include a Clade II outgroup sequence to correctly root the tree. This outgroup will be pruned from the final output tree, so will not be seen in the output file.
The respective outgroups automatically selected from the background set are:
cladei: "KJ642615|human|Nigeria||1978"
cladeia: "KJ642615|human|Nigeria||1978"
cladeib: "KJ642613|human|DRC|Equateur|1970-09-01"
cladeii: "KJ642613|human|DRC|Equateur|1970-09-01"
cladeiia: "KJ642613|human|DRC|Equateur|1970-09-01"
cladeiib: "KJ642615|human|Nigeria||1978"
Note that in this mode, if outgroups are specified in the supplied input file, they will not be used and they will remain in the final tree.
If you specify -qc
when also running in phylogenetics mode (so both the -qc
and --run-phylo
flags), additional checks with be performed after the reconstruction. Firstly, any mutations that occur multiple times across the phylogeny (convergent mutations) are flagged for investigation, as they may highlight an issue with the tree structure or underlying sequences.
Squirrel also flags any reversions to reference that occur in the phylogeny, which can flag issues with the assembly pipeline (often insufficient primer sequence trimming from reads or absent low-coverage masking). By default, the RefSeq records for each clade are checked against: NC_063383
and NC_003310
, however alternative references can be supplied with --assembly-refs
if your sequences of interest have been assembled using a different reference, or if the primer scheme used for sequencing was constructed using a different reference.
Occasionally, you may want to adjust the final APOBEC3-reconstruction tree figure output. There are now a number of options to help you achieve this.
Firstly, rather than having to rerun the entire analysis, there is now an option that allows the user to re-render the tree figure only (-tfig/--tree-figure-only
). The user must supply a tree file and matching branch reconstruction file that has been output by a previous squirrel run. This can be done with the -brf/--branch-reconstruction-file
and -tf/--tree-file
arguments.
Alongside these files, the user can then specify a custom height (--fig-height
) or width (--fig-width
) for the final tree vizualisation.
The user may now also specify whether the reconstructed mutations vizualised on the branch are either represented by a circle
hovering over the branch or a square
spanning the branch with the --point-style
argument, and whether they want the points to begin stacking from the left
or right
with --point-justify
.
Install from bioconda with conda
or mamba
, e.g. conda create -c bioconda -c conda-forge -n squirrel -y squirrel
.
Or:
- Clone this repository and
cd squirrel
- if
mamba
is not installed, runconda install -n base mamba
mamba env create -f environment.yml
conda activate squirrel
pip install .
Type (in the squirrel environment):
squirrel -v
and you should see the versions of squirrel.
usage: squirrel <input> [options]
squirrel: Some QUIck Rearranging to Resolve Evolutionary Links
options:
-h, --help show this help message and exit
Input-Output options:
input Input fasta file of sequences to analyse.
-o OUTDIR, --outdir OUTDIR
Output directory. Default: current working directory
--outfile OUTFILE Optional output file name. Default: <input>.aln.fasta
--tempdir TEMPDIR Specify where you want the temp stuff to go. Default: $TMPDIR
--no-temp Output all intermediate files, for dev purposes.
Alignment options:
-qc, --seq-qc Flag potentially problematic SNPs and sequences. Default: don't run QC
--assembly-refs ASSEMBLY_REFS
References to check for `calls to reference` against.
--no-mask Skip masking of repetitive regions. Default: masks repeat regions
--no-itr-mask Skip masking of end ITR. Default: masks ITR
--additional-mask ADDITIONAL_MASK
Masking additional sites provided as a csv. Needs columns `Maximum` and `Minimum` in 1-base.
--sequence-mask SEQUENCE_MASK
Mask sites in specific sequences in the alignment as a csv, rather than the whole alignment column. Needs `sequence` and `site` (1-based) column.
-ex EXCLUDE, --exclude EXCLUDE
Supply a csv file listing sequences that should be excluded from the analysis.
--extract-cds Extract coding sequences based on coordinates in the reference
--concatenate Concatenate coding sequences for each genome, separated by `NNN`. Default: write out as separate records
--clade CLADE Specify whether the alignment is primarily for `cladei` or `cladeii` (can also specify a or b, e.g. `cladeia`, `cladeiib`). This will determine reference used for alignment, mask file
and background set used if `--include-background` flag used in conjunction with the `--run-phylo` option. Default: `cladeii`
Phylo options:
-p, --run-phylo Run phylogenetics pipeline
-a, --run-apobec3-phylo
Run phylogenetics & APOBEC3-mutation reconstruction pipeline
--outgroups OUTGROUPS
Specify which MPXV outgroup(s) in the alignment to use in the phylogeny. These will get pruned out from the final tree.
-bg, --include-background
Include a default background set of sequences for the phylogenetics pipeline. The set will be determined by the `--clade` specified.
-bf BACKGROUND_FILE, --background-file BACKGROUND_FILE
Include this additional FASTA file as background to the phylogenetics.
-bm, --binary-partition-mask
Calculate and write binary partition mask
--bm-separate-dimers Write partition mask with 0 for non-apo, 1 for GA and 2 for TC target sites
Tree figure options:
-tfig, --tree-figure-only
Re-render tree figure custom height and width arguments. Requires: tree file, branch reconstruction file, height, width.
-tf TREE_FILE, --tree-file TREE_FILE
Tree for re-rendering the figure.
-brf BRANCH_RECONSTRUCTION_FILE, --branch-reconstruction-file BRANCH_RECONSTRUCTION_FILE
Reconstruction file for re-rendering the figure.
--fig-height FIG_HEIGHT
Overwrite tree figure default height.
--fig-width FIG_WIDTH
Overwrite tree figure default width.
--point-style POINT_STYLE
Shape of points for apobec3 reconstruction figure. Options: circle, square. Default: circle
--point-justify POINT_JUSTIFY
Justification of points for apobec3 reconstruction figure. Options: left, right. Default: left
Misc options:
-v, --version show program's version number and exit
--verbose Print lots of stuff to screen
-t THREADS, --threads THREADS
Number of threads
A FASTA-formatted file contains sequence records. A record minimally contains two pieces of information, the sequence ID (e.g. sequence1
) and the sequence itself (e.g. CGATCGAT...ACTGACT
). The sequence ID is stored in the header line, which is denoted by a >
symbol. The header line may also contain additional information (called the sequence description), which can be found after the first space on the header line (e.g. some_extra_information
in the example below). This is why it is important that the sequence ID does not contain whitespace (i.e. spaces or
). The sequence itself is then stored on the following line. Often the sequence is split across multiple lines for readability, but note that the next record does not start until the next line that begins with >
. An example of this split line display is below for the record containing sequence2.
Example FASTA with three sequence records:
>sequence1 some_extra_information
AGCTAGCTAGCGTAGCTAGCGCATTACGTACTACG
>sequence2 some_MORE_extra_information
AGCTAGCTAGCGTAGCTAGCGCATTACGTACTACG
GGCTAGCTAGCGTAGCTAGCGCATTACGTACTACT
TGCTAGCTAGCGTAGCTAGCGCATTACGTACTACA
ACGTAGTCATAGTCGTACTGAC
>sequence3
AGCTAGCTAGCGTAGCTAGCGCATTACGTACTACG