fixed bug that produced wrong overhang in linear, non-directional, si…

…ngle cut reactions. (#408)

* fixed bug that produced wrong overhang in linear, non-directional, single cut reactions.

CHANGELOG.md

@@ -7,28 +7,5 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 
 ## [Unreleased]
 
-### Added
-- Alternative start codons can now be used in the `synthesis/codon` DNA -> protein translation package (#305)
-- Added a parser and writer for the `pileup` sequence alignment format (#329)
-- Added statistics to the `synthesis/codon` package (keeping track of the observed start codon occurrences in a translation table) (#350)
-- Added option to fragmenter to fragment with only certain overhangs (#387)
-
-
-
-
 ### Fixed
-- `fastq` parser no longer becomes de-aligned when reading (#325)
-- `fastq` now handles optionals correctly (#323)
--  No more data race in GoldenGate (#276)
-
-### Breaking
-- CutWithEnzymeByName is now a receiver of EnzymeManager. GoldenGate now takes an Enzyme instead of the name of an enzyme.
-This is an effort to remove dependence on some package level global state and build some flexibility managing enzymes
-over the lifetime of the program.
-- Enzyme.OverhangLen is now named Enzyme.OverhangLength
-
-## [0.26.0] - 2023-07-22
-Oops, we weren't keeping a changelog before this tag!
-
-[unreleased]: https://github.com/TimothyStiles/poly/compare/v0.26.0...main
-[0.26.0]: https://github.com/TimothyStiles/poly/releases/tag/v0.26.0
+-  Fixed bug that produced wrong overhang in linear, non-directional, single cut reactions. #408 

clone/clone.go

@@ -188,7 +188,15 @@ func CutWithEnzyme(part Part, directional bool, enzyme Enzyme) []Fragment {
 		// In the case of a single cut in a linear sequence, we get two fragments with only 1 stick end
 		fragmentSequence1 := sequence[overhangs[0].Position+overhangs[0].Length:]
 		fragmentSequence2 := sequence[:overhangs[0].Position]
-		overhangSequence := sequence[overhangs[0].Position : overhangs[0].Position+overhangs[0].Length]
+
+		var overhangSequence string
+
+		if len(forwardOverhangs) > 0 {
+			overhangSequence = sequence[overhangs[0].Position : overhangs[0].Position+overhangs[0].Length]
+		} else {
+			overhangSequence = sequence[overhangs[0].Position-overhangs[0].Length : overhangs[0].Position]
+		}
+
 		fragments = append(fragments, Fragment{fragmentSequence1, overhangSequence, ""})
 		fragments = append(fragments, Fragment{fragmentSequence2, "", overhangSequence})
 		return fragments

clone/clone_test.go

@@ -96,6 +96,43 @@ func TestCutWithEnzyme(t *testing.T) {
 	}
 }
 
+func TestCutWithEnzymeRegression(t *testing.T) {
+	sequence := "AGCTGCTGTTTAAAGCTATTACTTTGAGACC" // this is a real sequence I came across that was causing problems
+
+	part := Part{sequence, false}
+
+	// get enzymes with enzyme manager
+	enzymeManager := NewEnzymeManager(GetBaseRestrictionEnzymes())
+	bsa1, err := enzymeManager.GetEnzymeByName("BsaI")
+	if err != nil {
+		t.Errorf("Error when getting Enzyme. Got error: %s", err)
+	}
+
+	// cut with BsaI
+	fragments := CutWithEnzyme(part, false, bsa1)
+
+	// check that the fragments are correct
+	if len(fragments) != 2 {
+		t.Errorf("Expected 2 fragments, got: %d", len(fragments))
+	}
+
+	if fragments[0].ForwardOverhang != "ACTT" {
+		t.Errorf("Expected forward overhang to be ACTT, got: %s", fragments[0].ForwardOverhang)
+	}
+
+	if fragments[0].ReverseOverhang != "" {
+		t.Errorf("Expected reverse overhang to be GAGT, got: %s", fragments[0].ReverseOverhang)
+	}
+
+	if fragments[1].ForwardOverhang != "" {
+		t.Errorf("Expected forward overhang to be empty, got: %s", fragments[1].ForwardOverhang)
+	}
+
+	if fragments[1].ReverseOverhang != "ACTT" {
+		t.Errorf("Expected reverse overhang to be GAGT, got: %s", fragments[1].ReverseOverhang)
+	}
+}
+
 func TestCircularLigate(t *testing.T) {
 	// The following tests for complementing overhangs. Specific, this line:
 	// newSeed := Fragment{seedFragment.Sequence + seedFragment.ReverseOverhang + ReverseComplement(newFragment.Sequence), seedFragment.ForwardOverhang, ReverseComplement(newFragment.ForwardOverhang)}