Add functions to write ORFs to different file formats

camilogarciabotero · Jan 10, 2024 · 6ce48ff · 6ce48ff
1 parent 7240c1e
commit 6ce48ff
Showing 1 changed file with 3 additions and 1 deletion.
diff --git a/README.md b/README.md
@@ -149,4 +149,6 @@ ATGTGA
 ATGTGTCCAACGGCAGCCTGA
 >ORF12 id=12 start=695 stop=706 strand=+ frame=2
 ATGCAACCCTGA
-```
+```
+
+This could also be done to writting a `FASTA` file with the nucleotide sequences of the ORFs using the `write_orfs_fna` function. Similarly for the `BED` and `GFF` files using the `write_orfs_bed` and `write_orfs_gff` functions respectively.