[Swift 6]: Update Exercises batch 11

exercises/practice/nucleotide-count/.meta/template.swift

@@ -1,24 +1,26 @@
-import XCTest
+import Testing
+import Foundation
 @testable import {{exercise|camelCase}}
-class {{exercise|camelCase}}Tests: XCTestCase {
-    let runAll = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
 
+let RUNALL = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
+
+@Suite struct {{exercise|camelCase}}Tests {
     {% for case in cases %}
     {% if forloop.first -%}
-        func test{{case.description |camelCase }}() {
+        @Test("{{case.description}}")
     {% else -%}
-        func test{{case.description |camelCase }}() throws {
-        try XCTSkipIf(true && !runAll) // change true to false to run this test
+        @Test("{{case.description}}", .enabled(if: RUNALL))
     {% endif -%}
+    func test{{case.description |camelCase }}() {
     {% if case.expected.error -%}
-        XCTAssertThrowsError(try DNA(strand: "{{case.input.strand}}")) { error in
-            XCTAssertEqual(error as? NucleotideCountErrors, NucleotideCountErrors.invalidNucleotide)
+        #expect(throws: NucleotideCountErrors.invalidNucleotide) {
+            try DNA(strand: "{{case.input.strand}}")
         }
     {% else -%}
         let dna = try! DNA(strand: "{{case.input.strand}}")
         let results = dna.counts()
         let expected = {{case.expected | toStringDictionary}}
-        XCTAssertEqual(results, expected)
+        #expect(results == expected)
     {% endif -%}
     }
     {% endfor -%}

exercises/practice/nucleotide-count/Package.swift

@@ -1,4 +1,4 @@
-// swift-tools-version:5.3
+// swift-tools-version:6.0
 
 import PackageDescription
 

exercises/practice/nucleotide-count/Tests/NucleotideCountTests/NucleotideCountTests.swift

@@ -1,46 +1,49 @@
-import XCTest
+import Foundation
+import Testing
 
 @testable import NucleotideCount
 
-class NucleotideCountTests: XCTestCase {
-  let runAll = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
+let RUNALL = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
 
+@Suite struct NucleotideCountTests {
+
+  @Test("empty strand")
   func testEmptyStrand() {
     let dna = try! DNA(strand: "")
     let results = dna.counts()
     let expected = ["A": 0, "C": 0, "G": 0, "T": 0]
-    XCTAssertEqual(results, expected)
+    #expect(results == expected)
   }
 
-  func testCanCountOneNucleotideInSingleCharacterInput() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("can count one nucleotide in single-character input", .enabled(if: RUNALL))
+  func testCanCountOneNucleotideInSingleCharacterInput() {
     let dna = try! DNA(strand: "G")
     let results = dna.counts()
     let expected = ["A": 0, "C": 0, "G": 1, "T": 0]
-    XCTAssertEqual(results, expected)
+    #expect(results == expected)
   }
 
-  func testStrandWithRepeatedNucleotide() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("strand with repeated nucleotide", .enabled(if: RUNALL))
+  func testStrandWithRepeatedNucleotide() {
     let dna = try! DNA(strand: "GGGGGGG")
     let results = dna.counts()
     let expected = ["A": 0, "C": 0, "G": 7, "T": 0]
-    XCTAssertEqual(results, expected)
+    #expect(results == expected)
   }
 
-  func testStrandWithMultipleNucleotides() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("strand with multiple nucleotides", .enabled(if: RUNALL))
+  func testStrandWithMultipleNucleotides() {
     let dna = try! DNA(
       strand: "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
     let results = dna.counts()
     let expected = ["A": 20, "C": 12, "G": 17, "T": 21]
-    XCTAssertEqual(results, expected)
+    #expect(results == expected)
   }
 
-  func testStrandWithInvalidNucleotides() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
-    XCTAssertThrowsError(try DNA(strand: "AGXXACT")) { error in
-      XCTAssertEqual(error as? NucleotideCountErrors, NucleotideCountErrors.invalidNucleotide)
+  @Test("strand with invalid nucleotides", .enabled(if: RUNALL))
+  func testStrandWithInvalidNucleotides() {
+    #expect(throws: NucleotideCountErrors.invalidNucleotide) {
+      try DNA(strand: "AGXXACT")
     }
   }
 }

exercises/practice/ocr-numbers/.meta/template.swift

@@ -1,22 +1,24 @@
-import XCTest
+import Testing
+import Foundation
 @testable import {{exercise|camelCase}}
-class {{exercise|camelCase}}Tests: XCTestCase {
-    let runAll = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
 
+let RUNALL = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
+
+@Suite struct {{exercise|camelCase}}Tests {
     {% for case in cases %}
     {% if forloop.first -%}
-        func test{{case.description |camelCase }}() {
+        @Test("{{case.description}}")
     {% else -%}
-        func test{{case.description |camelCase }}() throws {
-        try XCTSkipIf(true && !runAll) // change true to false to run this test
+        @Test("{{case.description}}", .enabled(if: RUNALL))
     {% endif -%}
+    func test{{case.description |camelCase }}() {
         let input = {{case.input.rows | toStringArray}}
         {% if case.expected.error -%}
-        XCTAssertThrowsError(try OcrNumber.convert(rows: input)) {
-            XCTAssertEqual($0 as? OcrNumberError, .invalidInput)
+        #expect(throws: OcrNumberError.invalidInput) {
+            try OcrNumber.convert(rows: input)
         }
         {% else -%}
-        XCTAssertEqual(try! OcrNumber.convert(rows: input), "{{case.expected}}")
+        #expect(try! OcrNumber.convert(rows: input) == "{{case.expected}}")
         {% endif -%}
     }
     {% endfor -%}

exercises/practice/ocr-numbers/Package.swift

@@ -1,4 +1,4 @@
-// swift-tools-version:5.3
+// swift-tools-version:6.0
 
 import PackageDescription
 

exercises/practice/ocr-numbers/Tests/OcrNumbersTests/OcrNumbersTests.swift

@@ -1,124 +1,133 @@
-import XCTest
+import Foundation
+import Testing
 
 @testable import OcrNumbers
 
-class OcrNumbersTests: XCTestCase {
-  let runAll = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
+let RUNALL = Bool(ProcessInfo.processInfo.environment["RUNALL", default: "false"]) ?? false
 
+@Suite struct OcrNumbersTests {
+
+  @Test("Recognizes 0")
   func testRecognizes0() {
     let input = [" _ ", "| |", "|_|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "0")
+    #expect(try! OcrNumber.convert(rows: input) == "0")
   }
 
-  func testRecognizes1() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 1", .enabled(if: RUNALL))
+  func testRecognizes1() {
     let input = ["   ", "  |", "  |", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "1")
+    #expect(try! OcrNumber.convert(rows: input) == "1")
   }
 
-  func testUnreadableButCorrectlySizedInputsReturn() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Unreadable but correctly sized inputs return ?", .enabled(if: RUNALL))
+  func testUnreadableButCorrectlySizedInputsReturn() {
     let input = ["   ", "  _", "  |", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "?")
+    #expect(try! OcrNumber.convert(rows: input) == "?")
   }
 
-  func testInputWithANumberOfLinesThatIsNotAMultipleOfFourRaisesAnError() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test(
+    "Input with a number of lines that is not a multiple of four raises an error",
+    .enabled(if: RUNALL))
+  func testInputWithANumberOfLinesThatIsNotAMultipleOfFourRaisesAnError() {
     let input = [" _ ", "| |", "   "]
-    XCTAssertThrowsError(try OcrNumber.convert(rows: input)) {
-      XCTAssertEqual($0 as? OcrNumberError, .invalidInput)
+    #expect(throws: OcrNumberError.invalidInput) {
+      try OcrNumber.convert(rows: input)
     }
   }
 
-  func testInputWithANumberOfColumnsThatIsNotAMultipleOfThreeRaisesAnError() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test(
+    "Input with a number of columns that is not a multiple of three raises an error",
+    .enabled(if: RUNALL))
+  func testInputWithANumberOfColumnsThatIsNotAMultipleOfThreeRaisesAnError() {
     let input = ["    ", "   |", "   |", "    "]
-    XCTAssertThrowsError(try OcrNumber.convert(rows: input)) {
-      XCTAssertEqual($0 as? OcrNumberError, .invalidInput)
+    #expect(throws: OcrNumberError.invalidInput) {
+      try OcrNumber.convert(rows: input)
     }
   }
 
-  func testRecognizes110101100() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 110101100", .enabled(if: RUNALL))
+  func testRecognizes110101100() {
     let input = [
       "       _     _        _  _ ", "  |  || |  || |  |  || || |", "  |  ||_|  ||_|  |  ||_||_|",
       "                           ",
     ]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "110101100")
+    #expect(try! OcrNumber.convert(rows: input) == "110101100")
   }
 
-  func testGarbledNumbersInAStringAreReplacedWith() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Garbled numbers in a string are replaced with ?", .enabled(if: RUNALL))
+  func testGarbledNumbersInAStringAreReplacedWith() {
     let input = [
       "       _     _           _ ", "  |  || |  || |     || || |", "  |  | _|  ||_|  |  ||_||_|",
       "                           ",
     ]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "11?10?1?0")
+    #expect(try! OcrNumber.convert(rows: input) == "11?10?1?0")
   }
 
-  func testRecognizes2() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 2", .enabled(if: RUNALL))
+  func testRecognizes2() {
     let input = [" _ ", " _|", "|_ ", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "2")
+    #expect(try! OcrNumber.convert(rows: input) == "2")
   }
 
-  func testRecognizes3() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 3", .enabled(if: RUNALL))
+  func testRecognizes3() {
     let input = [" _ ", " _|", " _|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "3")
+    #expect(try! OcrNumber.convert(rows: input) == "3")
   }
 
-  func testRecognizes4() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 4", .enabled(if: RUNALL))
+  func testRecognizes4() {
     let input = ["   ", "|_|", "  |", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "4")
+    #expect(try! OcrNumber.convert(rows: input) == "4")
   }
 
-  func testRecognizes5() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 5", .enabled(if: RUNALL))
+  func testRecognizes5() {
     let input = [" _ ", "|_ ", " _|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "5")
+    #expect(try! OcrNumber.convert(rows: input) == "5")
   }
 
-  func testRecognizes6() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 6", .enabled(if: RUNALL))
+  func testRecognizes6() {
     let input = [" _ ", "|_ ", "|_|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "6")
+    #expect(try! OcrNumber.convert(rows: input) == "6")
   }
 
-  func testRecognizes7() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 7", .enabled(if: RUNALL))
+  func testRecognizes7() {
     let input = [" _ ", "  |", "  |", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "7")
+    #expect(try! OcrNumber.convert(rows: input) == "7")
   }
 
-  func testRecognizes8() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 8", .enabled(if: RUNALL))
+  func testRecognizes8() {
     let input = [" _ ", "|_|", "|_|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "8")
+    #expect(try! OcrNumber.convert(rows: input) == "8")
   }
 
-  func testRecognizes9() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes 9", .enabled(if: RUNALL))
+  func testRecognizes9() {
     let input = [" _ ", "|_|", " _|", "   "]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "9")
+    #expect(try! OcrNumber.convert(rows: input) == "9")
   }
 
-  func testRecognizesStringOfDecimalNumbers() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test("Recognizes string of decimal numbers", .enabled(if: RUNALL))
+  func testRecognizesStringOfDecimalNumbers() {
     let input = [
       "    _  _     _  _  _  _  _  _ ", "  | _| _||_||_ |_   ||_||_|| |",
       "  ||_  _|  | _||_|  ||_| _||_|", "                              ",
     ]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "1234567890")
+    #expect(try! OcrNumber.convert(rows: input) == "1234567890")
   }
 
-  func testNumbersSeparatedByEmptyLinesAreRecognizedLinesAreJoinedByCommas() throws {
-    try XCTSkipIf(true && !runAll)  // change true to false to run this test
+  @Test(
+    "Numbers separated by empty lines are recognized. Lines are joined by commas.",
+    .enabled(if: RUNALL))
+  func testNumbersSeparatedByEmptyLinesAreRecognizedLinesAreJoinedByCommas() {
     let input = [
       "    _  _ ", "  | _| _|", "  ||_  _|", "         ", "    _  _ ", "|_||_ |_ ", "  | _||_|",
       "         ", " _  _  _ ", "  ||_||_|", "  ||_| _|", "         ",
     ]
-    XCTAssertEqual(try! OcrNumber.convert(rows: input), "123,456,789")
+    #expect(try! OcrNumber.convert(rows: input) == "123,456,789")
   }
 }