REPrise

Download highest version number from

https://github.com/hmdlab/REPrise

This assumes you have a C++ compiler.

make

Command and Options

Usage

REPrise [-input genome file] [-output outputname] [Options]

Options
(Required)
   -input  STR         input file name. You can input assembled genome file, or hard masked genome file
   -output STR         output file name. REPrise outputs STR.freq, STR.bed STR.masked and STR.reprof (consensus seqnences)

(Optional)
   -h                  Print help and exit
   -v                  Verbose
   -additonalfile      Output files about masked region(.masked and .bed)

   -match INT          Match score of the extension alignment (default = 1)
   -match INT          Mismatch score of the extension alignment (default = -1)
   -gap   INT          Gap open score of the extension alignment (default = -5)
   -gapex  INT         Gap extension score of the extension alignment (default = -1)
   -capplenalty INT    Penalty of the imcomplete length alignment (default = -20)
   -dist INT           Number of mismatches allowed in inexact seed (default = 0)

   -maxextend INT      Uppler limit length of extension in one side direction of consensus repeat (default = 10000)
   -maxrepeat INT      Maximum Number of elements belonging to one repeat family (default = 100000)
   -maxgap INT         Band size(= maximum number of gaps allowed) of extension alignment (default = 5)
   -stopafter INT      If the maximum score of extension alignment does not change INT consecutive times, that alignment will stop (default = 100)
   -minlength INT      Minimum number of length of the consensus sequence of repeat family(default = 50)
   -minfreq INT        Minimum number of elements  belonging to one repeat family (default = 3)
   -minimprovement INT Penalty associated with the number of regions to be extended as the repeat regions (default = 3)
   -tandemdist INT     Interval to match the same seed to avoid seed matching with tandem repeats(default = 500)

   -pa INT             Number of openMP parallel cores

-dist is a useful parameter for improving sensitivity, but it may increase the computation time significantly. Be careful when setting -dist to 2 or more! REPrise supports parallel computation with openMP, and we recommend using it if available.

Note that entering a large number of contigs ( approximately 10000 or more) at the same time may cause memory errors.

Usage

We highly recommend running CD-HIT for the REPrise output, to polish the repeat library. You can install latest version of cd-hit from https://github.com/weizhongli/cdhit.

Command example

REPrise -input genome.fa -output out -dist 1
cd-hit-est -i out.reprof -o clstr_out.reprof -c 0.8 -p 1

Use clstr_out.reprof as the repeat library of genome.fa.

Testcase

You can check the software execution by a test case.

REPrise -input test/tst.fa -output out -dist 1 -tandemdist 10

You will get out.freq and out.reprof. And out.reprof will look like:

>R=0, seedfreq=11, elementfreq=9, length=50, Seed=TCGTTATAGAAA
AGAAATATCTGCACGTTCGTTATAGAAAGTAGCCCCGTCGGACAAGACTG

License

This software is released under the MIT License, see LICENSE.txt.

Changelogs

2024/01/23 Version 1.0.0 relased.
2024/03/12 Version 1.0.1 relased: add "-additonalfile" option.

Reference

Atsushi Takeda†, Daisuke Nonaka†, Yuta Imazu, Tsukasa Fukunaga*, Michiaki Hamada*, REPrise: de novo interspersed repeat detection using inexact seeding, bioRxiv, https://doi.org/10.1101/2024.01.21.576581