Fix StrobemerIndex.find() in Python bindings

It previously returned an empty list (regression introduced in
59b4d04)

pyproject.toml

@@ -8,3 +8,6 @@ requires = [
     "ninja; platform_system!='Windows'",
     "nanobind>=0.2.0",
 ]
+
+[tool.pytest.ini_options]
+testpaths = ["tests"]

src/python/strobealign.cpp

@@ -108,8 +108,9 @@ NB_MODULE(strobealign_extension, m_) {
         .def_ro("syncmer", &IndexParameters::syncmer)
         .def_ro("randstrobe", &IndexParameters::randstrobe)
     ;
-    nb::class_<RefRandstrobe>(m, "RefRandstrobeWithHash", "Randstrobe on a reference")
+    nb::class_<RefRandstrobe>(m, "RefRandstrobe", "Randstrobe on a reference")
         .def_ro("position", &RefRandstrobe::position)
+        .def_ro("hash", &RefRandstrobe::hash)
         .def_prop_ro("reference_index", &RefRandstrobe::reference_index)
         .def_prop_ro("strobe2_offset", &RefRandstrobe::strobe2_offset)
     ;
@@ -119,11 +120,9 @@ NB_MODULE(strobealign_extension, m_) {
         .def("find", [](const StrobemerIndex& index, uint64_t key) -> std::vector<RefRandstrobe> {
             std::vector<RefRandstrobe> v;
             auto position = index.find(key);
-            if (position != index.end()) {
-                /*while (index.randstrobes[position].hash == key) {
-                    v.push_back(index.randstrobes[position]);
-                    position++;
-                }*/
+            while (position != index.end() && index.get_hash(position) == key) {
+                v.push_back(index.get_randstrobe(position));
+                position++;
             }
             return v;
         })

tests/test_bindings.py

@@ -41,3 +41,24 @@ def test_indexing_and_nams_finding():
         ref_aligned = ref[nam.ref_start:nam.ref_end]
         query_aligned = query[nam.query_start:nam.query_end]
         score = nam.score
+
+
+def test_index_find():
+    refs = strobealign.References.from_fasta("tests/phix.fasta")
+    index_parameters = strobealign.IndexParameters.from_read_length(100)
+    index = strobealign.StrobemerIndex(refs, index_parameters)
+    index.populate()
+
+    query = "TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG"
+    query_randstrobes = strobealign.randstrobes_query(query, index_parameters)
+    assert query_randstrobes
+    # First randstrobe must be found
+    assert index.find(query_randstrobes[0].hash)
+
+    n = 0
+    for qr in query_randstrobes:
+        for rs in index.find(qr.hash):
+            n += 1
+            assert rs.hash == qr.hash
+    # Ensure the for loop did test something
+    assert n > 1