Skip to content

Commit

Permalink
Added Rosario analysis
Browse files Browse the repository at this point in the history
  • Loading branch information
willbradshaw committed Apr 12, 2024
1 parent d496c27 commit 70c1a9a
Show file tree
Hide file tree
Showing 78 changed files with 38,534 additions and 9 deletions.
41 changes: 41 additions & 0 deletions data/2024-04-12_rosario/adapters.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,41 @@
>0
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
>1
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>2
heifigepsna
>3
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC
T
>4
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>5
CAAGCAGAAGACGGCATACGAGAT
>6
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>7
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>8
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>9
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>10
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>11
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>12
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>13
TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>14
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
>15
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>16
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
>17
unspecified
>18
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>19
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Binary file not shown.
105 changes: 105 additions & 0 deletions data/2024-04-12_rosario/bracken_counts.tsv
Original file line number Diff line number Diff line change
@@ -0,0 +1,105 @@
name taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads sample
Bacteria 2 D 52692 6 52698 0.65873 SRR5853131
Eukaryota 2759 D 27206 26 27232 0.3404 SRR5853131
Archaea 2157 D 32 0 32 4e-4 SRR5853131
Viruses 10239 D 37 0 37 4.6e-4 SRR5853131
Bacteria 2 D 13591 7 13598 0.64762 SRR5853127
Eukaryota 2759 D 7311 14 7325 0.34886 SRR5853127
Archaea 2157 D 30 0 30 0.00143 SRR5853127
Viruses 10239 D 43 0 43 0.00205 SRR5853127
Eukaryota 2759 D 33058 34 33092 0.6138 SRR5853125
Bacteria 2 D 20641 5 20646 0.38295 SRR5853125
Archaea 2157 D 73 0 73 0.00135 SRR5853125
Viruses 10239 D 100 0 100 0.00185 SRR5853125
Eukaryota 2759 D 98064 35 98099 0.746 SRR5853144
Bacteria 2 D 33145 26 33171 0.25225 SRR5853144
Archaea 2157 D 8 0 8 6e-5 SRR5853144
Viruses 10239 D 212 9 221 0.00168 SRR5853144
Eukaryota 2759 D 145136 61 145197 0.76421 SRR5853124
Bacteria 2 D 44403 18 44421 0.2338 SRR5853124
Archaea 2157 D 62 0 62 3.3e-4 SRR5853124
Viruses 10239 D 312 1 313 0.00165 SRR5853124
Eukaryota 2759 D 123970 53 124023 0.70438 SRR5853147
Bacteria 2 D 51636 56 51692 0.29358 SRR5853147
Archaea 2157 D 17 0 17 1e-4 SRR5853147
Viruses 10239 D 336 3 339 0.00193 SRR5853147
Bacteria 2 D 15818 5 15823 0.59809 SRR5853123
Eukaryota 2759 D 10505 18 10523 0.39775 SRR5853123
Archaea 2157 D 54 0 54 0.00204 SRR5853123
Viruses 10239 D 55 0 55 0.00208 SRR5853123
Eukaryota 2759 D 171880 52 171932 0.85984 SRR5853132
Bacteria 2 D 27277 32 27309 0.13657 SRR5853132
Archaea 2157 D 9 0 9 5e-5 SRR5853132
Viruses 10239 D 706 0 706 0.00353 SRR5853132
Bacteria 2 D 23143 8 23151 0.69873 SRR5853128
Eukaryota 2759 D 9802 26 9828 0.29662 SRR5853128
Archaea 2157 D 59 0 59 0.00178 SRR5853128
Viruses 10239 D 93 0 93 0.00281 SRR5853128
Eukaryota 2759 D 42760 30 42790 0.60158 SRR5853148
Bacteria 2 D 28069 30 28099 0.39504 SRR5853148
Archaea 2157 D 5 0 5 7e-5 SRR5853148
Viruses 10239 D 230 3 233 0.00328 SRR5853148
Eukaryota 2759 D 96400 54 96454 0.79326 SRR5853145
Bacteria 2 D 25034 22 25056 0.20607 SRR5853145
Archaea 2157 D 13 0 13 1.1e-4 SRR5853145
Viruses 10239 D 67 1 68 5.6e-4 SRR5853145
Eukaryota 2759 D 68344 49 68393 0.57312 SRR5853140
Bacteria 2 D 48742 46 48788 0.40884 SRR5853140
Archaea 2157 D 9 0 9 8e-5 SRR5853140
Viruses 10239 D 2135 7 2142 0.01795 SRR5853140
Eukaryota 2759 D 36882 33 36915 0.52574 SRR5853137
Bacteria 2 D 32757 16 32773 0.46675 SRR5853137
Archaea 2157 D 60 0 60 8.5e-4 SRR5853137
Viruses 10239 D 465 0 465 0.00662 SRR5853137
Eukaryota 2759 D 39600 93 39693 0.59161 SRR5853133
Bacteria 2 D 26270 94 26364 0.39295 SRR5853133
Archaea 2157 D 16 0 16 2.4e-4 SRR5853133
Viruses 10239 D 1006 12 1018 0.01517 SRR5853133
Bacteria 2 D 27595 39 27634 0.76455 SRR5853139
Eukaryota 2759 D 7963 23 7986 0.22095 SRR5853139
Archaea 2157 D 64 0 64 0.00177 SRR5853139
Viruses 10239 D 428 31 459 0.0127 SRR5853139
Eukaryota 2759 D 24667 28 24695 0.56764 SRR5853122
Bacteria 2 D 18591 11 18602 0.42758 SRR5853122
Archaea 2157 D 46 0 46 0.00106 SRR5853122
Viruses 10239 D 159 1 160 0.00368 SRR5853122
Eukaryota 2759 D 60858 48 60906 0.60764 SRR5853146
Bacteria 2 D 36346 33 36379 0.36294 SRR5853146
Archaea 2157 D 113 0 113 0.00113 SRR5853146
Viruses 10239 D 2832 1 2833 0.02826 SRR5853146
Eukaryota 2759 D 69012 42 69054 0.59244 SRR5853141
Bacteria 2 D 47146 31 47177 0.40475 SRR5853141
Archaea 2157 D 9 0 9 8e-5 SRR5853141
Viruses 10239 D 316 1 317 0.00272 SRR5853141
Bacteria 2 D 19442 9 19451 0.51556 SRR5853129
Eukaryota 2759 D 18090 30 18120 0.48028 SRR5853129
Archaea 2157 D 39 0 39 0.00103 SRR5853129
Viruses 10239 D 117 0 117 0.0031 SRR5853129
Eukaryota 2759 D 615098 205 615303 0.99542 SRR5853149
Bacteria 2 D 2813 0 2813 0.00455 SRR5853149
Archaea 2157 D 2 0 2 0 SRR5853149
Viruses 10239 D 12 0 12 2e-5 SRR5853149
Eukaryota 2759 D 27478 30 27508 0.52723 SRR5853130
Bacteria 2 D 24327 19 24346 0.46662 SRR5853130
Archaea 2157 D 52 0 52 0.001 SRR5853130
Viruses 10239 D 261 6 267 0.00512 SRR5853130
Bacteria 2 D 25695 37 25732 0.83749 SRR5853138
Eukaryota 2759 D 4658 25 4683 0.15242 SRR5853138
Archaea 2157 D 72 0 72 0.00234 SRR5853138
Viruses 10239 D 230 7 237 0.00771 SRR5853138
Bacteria 2 D 42731 29 42760 0.63481 SRR5853136
Eukaryota 2759 D 23253 44 23297 0.34586 SRR5853136
Archaea 2157 D 90 0 90 0.00134 SRR5853136
Viruses 10239 D 1200 10 1210 0.01796 SRR5853136
Eukaryota 2759 D 205366 53 205419 0.82829 SRR5853143
Bacteria 2 D 42307 22 42329 0.17068 SRR5853143
Archaea 2157 D 17 0 17 7e-5 SRR5853143
Viruses 10239 D 239 0 239 9.6e-4 SRR5853143
Eukaryota 2759 D 41496 22 41518 0.81962 SRR5853134
Bacteria 2 D 8656 66 8722 0.17218 SRR5853134
Archaea 2157 D 2 0 2 4e-5 SRR5853134
Viruses 10239 D 411 0 411 0.00811 SRR5853134
Eukaryota 2759 D 49882 35 49917 0.81505 SRR5853135
Bacteria 2 D 11210 69 11279 0.18416 SRR5853135
Archaea 2157 D 7 0 7 1.1e-4 SRR5853135
Viruses 10239 D 40 0 40 6.5e-4 SRR5853135
Binary file added data/2024-04-12_rosario/hv_clade_counts.tsv.gz
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Loading

0 comments on commit 70c1a9a

Please sign in to comment.