Skip to content

Commit

Permalink
Added Prussin analysis
Browse files Browse the repository at this point in the history
  • Loading branch information
willbradshaw committed Apr 12, 2024
1 parent 59857db commit bdf0957
Show file tree
Hide file tree
Showing 113 changed files with 55,687 additions and 482 deletions.
45 changes: 45 additions & 0 deletions data/2024-04-11_prussin/adapters.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,45 @@
>0
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>1
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
>2
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>3
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>4
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>5
GGCTCAAACCATGCACCGAAGCTACGGGTATCATCTTTTGATGATGCGGTAGAGGAGCGT
>6
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>7
ACGCTCCTCTACCGCATCATCAAAAGATGATACCCGTAGCTTCGGTGCATGGTTTGAGCC
>8
heifigepsna
>9
unspecified
>10
TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>11
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
>12
CAAGCAGAAGACGGCATACGAGAT
>13
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
>14
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>15
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
>16
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>17
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>18
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>19
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC
T
>20
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>21
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Binary file not shown.
129 changes: 129 additions & 0 deletions data/2024-04-11_prussin/bracken_counts.tsv
Original file line number Diff line number Diff line change
@@ -0,0 +1,129 @@
name taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads sample
Eukaryota 2759 D 23114 29 23143 0.76011 SRR8663608
Bacteria 2 D 6306 12 6318 0.20751 SRR8663608
Archaea 2157 D 10 0 10 3.3e-4 SRR8663608
Viruses 10239 D 975 0 975 0.03202 SRR8663608
Bacteria 2 D 4858723 155 4858878 0.96863 SRR8663601
Eukaryota 2759 D 157096 50 157146 0.03133 SRR8663601
Archaea 2157 D 114 0 114 2e-5 SRR8663601
Viruses 10239 D 112 0 112 2e-5 SRR8663601
Eukaryota 2759 D 2020112 2501 2022613 0.87927 SRR8663623
Bacteria 2 D 273553 521 274074 0.11915 SRR8663623
Archaea 2157 D 998 0 998 4.3e-4 SRR8663623
Viruses 10239 D 2608 25 2633 0.00114 SRR8663623
Eukaryota 2759 D 12876337 8753 12885090 0.77634 SRR8663617
Bacteria 2 D 3697581 2422 3700003 0.22293 SRR8663617
Archaea 2157 D 6559 0 6559 4e-4 SRR8663617
Viruses 10239 D 5444 89 5533 3.3e-4 SRR8663617
Eukaryota 2759 D 15931509 12059 15943568 0.7655 SRR8663615
Bacteria 2 D 4869174 3112 4872286 0.23393 SRR8663615
Archaea 2157 D 6713 0 6713 3.2e-4 SRR8663615
Viruses 10239 D 4982 125 5107 2.5e-4 SRR8663615
Eukaryota 2759 D 2618585 2592 2621177 0.89805 SRR8663620
Bacteria 2 D 291171 495 291666 0.09993 SRR8663620
Archaea 2157 D 1103 0 1103 3.8e-4 SRR8663620
Viruses 10239 D 4789 12 4801 0.00164 SRR8663620
Eukaryota 2759 D 3179073 2287 3181360 0.63287 SRR8663619
Bacteria 2 D 1841428 704 1842132 0.36646 SRR8663619
Archaea 2157 D 1455 0 1455 2.9e-4 SRR8663619
Viruses 10239 D 1888 15 1903 3.8e-4 SRR8663619
Eukaryota 2759 D 2131400 2592 2133992 0.89031 SRR8663622
Bacteria 2 D 258666 380 259046 0.10808 SRR8663622
Archaea 2157 D 935 0 935 3.9e-4 SRR8663622
Viruses 10239 D 2891 31 2922 0.00122 SRR8663622
Eukaryota 2759 D 4468846 2761 4471607 0.90883 SRR8663627
Bacteria 2 D 443530 658 444188 0.09028 SRR8663627
Archaea 2157 D 1505 0 1505 3.1e-4 SRR8663627
Viruses 10239 D 2842 21 2863 5.8e-4 SRR8663627
Bacteria 2 D 6453514 198 6453712 0.9413 SRR8663600
Eukaryota 2759 D 402127 104 402231 0.05867 SRR8663600
Archaea 2157 D 148 0 148 2e-5 SRR8663600
Viruses 10239 D 83 0 83 1e-5 SRR8663600
Eukaryota 2759 D 6950380 4713 6955093 0.76802 SRR8663604
Bacteria 2 D 2094895 1301 2096196 0.23147 SRR8663604
Archaea 2157 D 2294 0 2294 2.5e-4 SRR8663604
Viruses 10239 D 2212 48 2260 2.5e-4 SRR8663604
Eukaryota 2759 D 2315070 2745 2317815 0.89866 SRR8663621
Bacteria 2 D 256987 430 257417 0.09981 SRR8663621
Archaea 2157 D 911 0 911 3.5e-4 SRR8663621
Viruses 10239 D 3036 9 3045 0.00118 SRR8663621
Eukaryota 2759 D 4329068 3381 4332449 0.65941 SRR8663610
Bacteria 2 D 2230419 1179 2231598 0.33966 SRR8663610
Archaea 2157 D 1934 0 1934 2.9e-4 SRR8663610
Viruses 10239 D 4139 25 4164 6.3e-4 SRR8663610
Eukaryota 2759 D 6715965 5636 6721601 0.66434 SRR8663605
Bacteria 2 D 3387664 2144 3389808 0.33504 SRR8663605
Archaea 2157 D 2830 0 2830 2.8e-4 SRR8663605
Viruses 10239 D 3439 38 3477 3.4e-4 SRR8663605
Bacteria 2 D 4804040 1353 4805393 0.71165 SRR8663606
Eukaryota 2759 D 1939671 2381 1942052 0.28761 SRR8663606
Archaea 2157 D 2418 0 2418 3.6e-4 SRR8663606
Viruses 10239 D 2596 11 2607 3.9e-4 SRR8663606
Eukaryota 2759 D 5797094 4420 5801514 0.70566 SRR8663613
Bacteria 2 D 2412241 1172 2413413 0.29355 SRR8663613
Archaea 2157 D 2612 0 2612 3.2e-4 SRR8663613
Viruses 10239 D 3841 28 3869 4.7e-4 SRR8663613
Eukaryota 2759 D 14475 19 14494 0.66925 SRR8663609
Bacteria 2 D 6474 11 6485 0.29944 SRR8663609
Archaea 2157 D 5 0 5 2.3e-4 SRR8663609
Viruses 10239 D 672 0 672 0.03103 SRR8663609
Eukaryota 2759 D 3261369 2536 3263905 0.90304 SRR8663628
Bacteria 2 D 346222 544 346766 0.09594 SRR8663628
Archaea 2157 D 1554 0 1554 4.3e-4 SRR8663628
Viruses 10239 D 2098 28 2126 5.9e-4 SRR8663628
Eukaryota 2759 D 3890470 3542 3894012 0.88618 SRR8663598
Bacteria 2 D 488469 681 489150 0.11132 SRR8663598
Archaea 2157 D 1902 0 1902 4.3e-4 SRR8663598
Viruses 10239 D 9058 17 9075 0.00207 SRR8663598
Eukaryota 2759 D 4554828 3549 4558377 0.71166 SRR8663611
Bacteria 2 D 1841167 959 1842126 0.28759 SRR8663611
Archaea 2157 D 1958 0 1958 3.1e-4 SRR8663611
Viruses 10239 D 2794 51 2845 4.4e-4 SRR8663611
Eukaryota 2759 D 740508 709 741217 0.65795 SRR8663629
Bacteria 2 D 383307 272 383579 0.34049 SRR8663629
Archaea 2157 D 699 0 699 6.2e-4 SRR8663629
Viruses 10239 D 1056 2 1058 9.4e-4 SRR8663629
Eukaryota 2759 D 4082341 2951 4085292 0.68913 SRR8663614
Bacteria 2 D 1838109 784 1838893 0.3102 SRR8663614
Archaea 2157 D 2149 0 2149 3.6e-4 SRR8663614
Viruses 10239 D 1795 16 1811 3.1e-4 SRR8663614
Eukaryota 2759 D 2354891 2349 2357240 0.86425 SRR8663626
Bacteria 2 D 363337 580 363917 0.13343 SRR8663626
Archaea 2157 D 906 0 906 3.3e-4 SRR8663626
Viruses 10239 D 5413 9 5422 0.00199 SRR8663626
Eukaryota 2759 D 6198690 3751 6202441 0.91084 SRR8663603
Bacteria 2 D 599468 977 600445 0.08818 SRR8663603
Archaea 2157 D 2598 0 2598 3.8e-4 SRR8663603
Viruses 10239 D 4072 55 4127 6.1e-4 SRR8663603
Eukaryota 2759 D 4519228 2808 4522036 0.90716 SRR8663599
Bacteria 2 D 458033 691 458724 0.09202 SRR8663599
Archaea 2157 D 1796 0 1796 3.6e-4 SRR8663599
Viruses 10239 D 2264 28 2292 4.6e-4 SRR8663599
Eukaryota 2759 D 6296110 5024 6301134 0.72846 SRR8663607
Bacteria 2 D 2342386 1298 2343684 0.27095 SRR8663607
Archaea 2157 D 3132 0 3132 3.6e-4 SRR8663607
Viruses 10239 D 2002 31 2033 2.4e-4 SRR8663607
Eukaryota 2759 D 4983881 3909 4987790 0.68704 SRR8663612
Bacteria 2 D 2264835 1027 2265862 0.31211 SRR8663612
Archaea 2157 D 2349 0 2349 3.2e-4 SRR8663612
Viruses 10239 D 3767 20 3787 5.2e-4 SRR8663612
Eukaryota 2759 D 1353957 1958 1355915 0.85703 SRR8663624
Bacteria 2 D 221917 313 222230 0.14046 SRR8663624
Archaea 2157 D 568 0 568 3.6e-4 SRR8663624
Viruses 10239 D 3385 4 3389 0.00214 SRR8663624
Eukaryota 2759 D 16240454 11556 16252010 0.77795 SRR8663616
Bacteria 2 D 4622185 2974 4625159 0.2214 SRR8663616
Archaea 2157 D 6551 0 6551 3.1e-4 SRR8663616
Viruses 10239 D 7029 117 7146 3.4e-4 SRR8663616
Eukaryota 2759 D 7994576 4641 7999217 0.91032 SRR8663602
Bacteria 2 D 778005 1429 779434 0.0887 SRR8663602
Archaea 2157 D 2960 0 2960 3.4e-4 SRR8663602
Viruses 10239 D 5601 79 5680 6.5e-4 SRR8663602
Eukaryota 2759 D 9282055 7402 9289457 0.63742 SRR8663618
Bacteria 2 D 5270095 2864 5272959 0.36182 SRR8663618
Archaea 2157 D 4454 0 4454 3.1e-4 SRR8663618
Viruses 10239 D 6519 59 6578 4.5e-4 SRR8663618
Eukaryota 2759 D 2074031 2319 2076350 0.86058 SRR8663625
Bacteria 2 D 331748 444 332192 0.13768 SRR8663625
Archaea 2157 D 869 0 869 3.6e-4 SRR8663625
Viruses 10239 D 3315 11 3326 0.00138 SRR8663625
Binary file added data/2024-04-11_prussin/hv_clade_counts.tsv.gz
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Loading

0 comments on commit bdf0957

Please sign in to comment.