Release PR for 2.5.2 #568

jfy133 · 2024-02-02T08:45:44Z

PR checklist

Post-release version bump to dev

…re accessible

…ests

Important! Template update for nf-core/tools v2.11

Co-authored-by: James A. Fellows Yates <[email protected]>

Add CAT summary into the global `bin_summary`

Important! Template update for nf-core/tools v2.12

…empty

Add warning GTDB-TK results will be empty if no contigs pass completeness filter

Tweak order of MultiQC sections to better match workflow

Bump version for 2.5.2 reelase

github-actions · 2024-02-02T08:47:49Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit 9f4aa1d

+| ✅ 210 tests passed       |+
#| ❔   3 tests were ignored |#
!| ❗   5 tests had warnings |!

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 2.5.2
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in WorkflowMag.groovy: Optionally add in-text citation tools to this list.
schema_lint - Input mimetype is missing or empty

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference
files_unchanged - File ignored due to lint config: lib/NfcoreTemplate.groovy

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: lib/NfcoreTemplate.groovy
files_exist - File found: lib/Utils.groovy
files_exist - File found: lib/WorkflowMain.groovy
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: lib/WorkflowMag.groovy
files_exist - File found: modules.json
files_exist - File found: pyproject.toml
files_exist - File not found check: Singularity
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
nextflow_config - Config default value correct: params.gtdbtk_pplacer_scratch= true
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
files_unchanged - pyproject.toml matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (239 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: awstest.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - 'assets/multiqc_config.yml' contains report_section_order
multiqc_config - 'assets/multiqc_config.yml' contains export_plots
multiqc_config - 'assets/multiqc_config.yml' contains report_comment
multiqc_config - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins.
multiqc_config - 'assets/multiqc_config.yml' contains a matching 'report_comment'.
multiqc_config - 'assets/multiqc_config.yml' contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'

Run details

nf-core/tools version 2.12.1
Run at 2024-02-02 14:03:45

jfy133 · 2024-02-02T10:39:51Z

@nf-core-bot fix linting

Update devcontainer.json for linting

nextflow.config

maxibor · 2024-02-02T13:34:18Z

Looks good, just one comment (according to https://nf-co.re/docs/contributing/pipeline_release_review_guidelines): some contributors are missing in the README (at least @CarsonJM as far as I can see)

Add newer major contributors

FriederikeHanssen

The scripts should get licenses at some point

jfy133 · 2024-02-02T14:10:18Z

The scripts should get licenses at some point

Yup, Maxime pointed this out too 😬 - need to find original authors or come up with best way to put e.g. nf-core communtiy or something, but will take a bit of time. Made an issue already #570

jfy133 and others added 30 commits November 17, 2023 05:39

Post-release version bump to dev

218eccd

Harshil align

26d3bf4

Merge pull request #542 from nf-core/post-release-version-bump

9c3f02f

Post-release version bump to dev

fix: centrifuge db needs to be a tuple

ed75993

patch commits

5b90387

fix: remove duplicated code

bd97618

cleanup: remove dump logs

d2f6f60

Template update for nf-core/tools version 2.11

f884170

Template update for nf-core/tools version 2.11.1

7ef749c

First pass of bug fix, to be tested again

a0831d9

Update BUSCO db in tests to latest version as older version not anymo…

8e4c7b6

…re accessible

Update last URL

78a7ee0

Merge branch 'dev' into nf-core-template-merge-2.11

c66ed48

Fix BUSCO download links due to deprecation of old verison of db in t…

c2f44fe

…ests

Simplify CAT_FASTQ branch condition, and remove misplaced flatten()

4bc12ef

Remove unnecessary space

ec06db8

Remove leftover TODO

2f6f2d0

Better commenting

5d013e5

Remove superfluous .map()

947dbd5

Add comment for of run merging group tuple structure

50eaeab

Fix linting

42317ee

Update nextflow.config to fix docker.runOptions

192c86f

Merge pull request #553 from nf-core/nf-core-template-merge-2.11

c79c5d4

Important! Template update for nf-core/tools v2.11

Merge branch 'dev' into fix-cat-se-data-dev

d914a1c

[automated] Fix linting with Prettier

ff0c4aa

Update workflows/mag.nf

c5ae764

Co-authored-by: James A. Fellows Yates <[email protected]>

Update workflows/mag.nf

c3373ee

Co-authored-by: James A. Fellows Yates <[email protected]>

Update subworkflows/local/gtdbtk.nf

2c41bab

Co-authored-by: James A. Fellows Yates <[email protected]>

Update subworkflows/local/gtdbtk.nf

ea568df

Co-authored-by: James A. Fellows Yates <[email protected]>

Update CLASSIFYWF to fix find glob issue

629e667

CarsonJM and others added 17 commits February 1, 2024 16:54

Fixed linting in usage.md

a8a0e94

Fixed docker.runOptions merge error

ebfb6d3

Update CHANGELOG.md

dabc167

Tweak order of MultiQC sections to better match workflow order

ef82701

Fix author

3b2f070

Merge pull request #562 from maxibor/add_cat_2_summary

15650d8

Add CAT summary into the global `bin_summary`

Merge branch 'dev' into warn-when-gtdb-filter-empty

3ead481

Update .nf-core.yml

428a0d3

[automated] Fix linting with Prettier

3ca1229

Merge pull request #563 from nf-core/nf-core-template-merge-2.12

5a614d9

Important! Template update for nf-core/tools v2.12

Merge remote-tracking branch 'origin/dev' into warn-when-gtdb-filter-…

c49febd

…empty

Merge remote-tracking branch 'origin/dev' into multiqc-tweak

2a3eb28

Merge pull request #565 from nf-core/warn-when-gtdb-filter-empty

601114d

Add warning GTDB-TK results will be empty if no contigs pass completeness filter

Merge pull request #566 from nf-core/multiqc-tweak

61376a8

Tweak order of MultiQC sections to better match workflow

Update CHANGELOG and bump version for reelase

08d197b

Typo fix

409b7f8

Merge pull request #567 from nf-core/bump-version-for-reelase

7b75454

Bump version for 2.5.2 reelase

nf-core-bot and others added 3 commits February 2, 2024 10:40

[automated] Fix linting with Prettier

e49efec

Update devcontainer.json for linting

eeb59d8

Merge pull request #569 from nf-core/jfy133-patch-1

da7a7a0

Update devcontainer.json for linting

maxibor reviewed Feb 2, 2024

View reviewed changes

nextflow.config Show resolved Hide resolved

maxibor approved these changes Feb 2, 2024

View reviewed changes

jfy133 added 2 commits February 2, 2024 14:43

Add newer major contributors

6bae89e

Merge pull request #571 from nf-core/jfy133-patch-1

9f4aa1d

Add newer major contributors

FriederikeHanssen approved these changes Feb 2, 2024

View reviewed changes

jfy133 merged commit 274412a into master Feb 2, 2024
27 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release PR for 2.5.2 #568

Release PR for 2.5.2 #568

jfy133 commented Feb 2, 2024

github-actions bot commented Feb 2, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

jfy133 commented Feb 2, 2024

maxibor commented Feb 2, 2024

FriederikeHanssen left a comment

jfy133 commented Feb 2, 2024

Release PR for 2.5.2 #568

Release PR for 2.5.2 #568

Conversation

jfy133 commented Feb 2, 2024

PR checklist

github-actions bot commented Feb 2, 2024 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

jfy133 commented Feb 2, 2024

maxibor commented Feb 2, 2024

FriederikeHanssen left a comment

Choose a reason for hiding this comment

jfy133 commented Feb 2, 2024

github-actions bot commented Feb 2, 2024 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️