-
Notifications
You must be signed in to change notification settings - Fork 1
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
when -s is selected, the fasta output is grouped by motif for ease of comparison when -s is not selected, the output is per organism. this may change in the future, may be confusing.
- Loading branch information
Showing
25 changed files
with
36 additions
and
67 deletions.
There are no files selected for viewing
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Empty file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +0,0 @@ | ||
>KJ746516.1 - d1d1 | ||
GACAAACTGATCATGATGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +0,0 @@ | ||
>KM438182.1 - d1d1.0 | ||
GACCAAACCCATTAGACTCTGAAACAATTTGGAATAGGAGCTAGTGAGGTC | ||
>KM438182.1 - d1d1.1 | ||
GACCAAACCCATTAGACTCTGAAACAATTTGGAATAGGAGCTAGTGAGGTCATCCTAGGTC | ||
>KM438182.1 - d1d1.2 | ||
GACCAAACCCATTAGACTCTGAAACAATTTGGAATAGGAGCTAGTGAGGTCATCCTAGGTCGCAACGAGGGGCAACTGGAGATGCTTTCAAACTAGAGTTCAGGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +0,0 @@ | ||
>KM438187.1 - d1d1.0 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTTAAGAGGAGCGAGTGAGGTC | ||
>KM438187.1 - d1d1.1 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTTAAGAGGAGCGAGTGAGGTCATCCTAGGTC | ||
>KM438187.1 - d1d1.2 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTTAAGAGGAGCGAGTGAGGTCATCCTAGGTCGGGATGAGGGGCAAACCCAGCTTTCAAACTAGAGTTCAGGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +0,0 @@ | ||
>KM438189.1 - d1d1.0 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTC | ||
>KM438189.1 - d1d1.1 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTCATCCTAGGTC | ||
>KM438189.1 - d1d1.2 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTCATCCTAGGTCGGGATGAGGGGCAAACCCAGCTTTCAAACTAGAGTTCAGGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +0,0 @@ | ||
>KU925869.1 - d1d1 | ||
GACAAACCTGATCATGATGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +0,0 @@ | ||
>KY379857.1 - d1d1 | ||
GACAAACCTAATCGTGATGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +0,0 @@ | ||
>KY379868.1 - d1d1 | ||
GACAAACCTAATCGTGATGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +0,0 @@ | ||
>MF351541.1 - d1d1.0 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTC | ||
>MF351541.1 - d1d1.1 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTCATCCTAGGTC | ||
>MF351541.1 - d1d1.2 | ||
GACCTAACCCATTCGACTCCGAAAAAAAGTCAATAGGAGAGGATGAGGTCATCCTAGGTCGGGATGAGGGGCAAACCCAGCTTTCAAACTAGAGTTCAGGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,4 +0,0 @@ | ||
>MT488084.1 - d1d1 | ||
GACCTACCCACTTTTACTTAAGGGCAACATGTTGTCGAACGAGTAAGAGTTGGTCATCCCAAGGTC | ||
>MT488084.1 - V3 | ||
GTAGTCAAAGCGATATCTGTTTGAATGAATGAGTGTGTTTATTCGCATGAGTTTATTTGGATAGGTGTTGAAAGAAGACAAGAAGACACCAATGATTATTTTGTGGTCAAGCTACAAAGGGCTGATGGTGGATACCTAGGCACAC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +0,0 @@ | ||
>MT488195.1 - d1d1.0 | ||
GACCTATTTGCCGTTGACCTCTTCTTAGTATTAAGGTC | ||
>MT488195.1 - d1d1.1 | ||
GACCTATTTGCCGTTGACCTCTTCTTAGTATTAAGGTCACACAGGCAAGTCATCCTAGGTC | ||
>MT488195.1 - V3 | ||
GTAGTTCTCAGTCATGAGTGAACAGTCAAGGGAGATTTAATGAAATCGCCTGGACTAGGAAACGAATGACTGGTGAAAAGACGTATCACAG | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +0,0 @@ | ||
>ON685819.1 - d1d1 | ||
GACCTACCCACTTTTACTTAAGGGCAACATGTTGTCGAACGAGTAAGAGTTGGTCATCCCAAGGTC | ||
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>KJ746516.1 - d1d1 | ||
GACAAACTGATCATGATGTC |