ChangChang manual

changchang

The goal of changchang is to …

Installation instructions

Get the latest stable R release from CRAN. Then install changchang from Bioconductor using the following code:

if (!requireNamespace("BiocManager", quietly = TRUE)) {
    install.packages("BiocManager")
}

BiocManager::install("changchang")

Input data

tantan

To load output of tantan the simplest at the moment is to convert its output to BED format and use the loadTantan() function. Here is an exmaple on how to produce the BED file.

tantan -w 10 -f4 example.fasta | tee example.tantan.txt | awk 'OFS="\t" {print $1, $2, $3, $6, $5, "."}'  > example.tantan.bed

Other tandem repeat finder softwares

Not supported yet. Patches welcome!

Example

This is a basic example which shows you how to solve a common problem:

library("changchang") |> suppressPackageStartupMessages()
loadTantan(system.file('extdata/example.bed.xz', package="changchang"))
#> GRanges object with 1000 ranges and 3 metadata columns:
#>            seqnames          ranges strand |     score
#>               <Rle>       <IRanges>  <Rle> | <numeric>
#>      [1] 1086a8205b           1-613      + | 102.66700
#>      [2] 1086a8205b         645-767      + |   3.42857
#>      [3] 1086a8205b        766-6420      + | 106.67900
#>      [4] 1086a8205b       7381-7473      + |   2.26829
#>      [5] 1086a8205b       8178-8206      - |   2.23077
#>      ...        ...             ...    ... .       ...
#>    [996] 1086a8205b 1706037-1706047      - |   5.50000
#>    [997] 1086a8205b 1706066-1706079      - |   2.80000
#>    [998] 1086a8205b 1706963-1706986      + |   3.25000
#>    [999] 1086a8205b 1707022-1707042      + |   4.20000
#>   [1000] 1086a8205b 1707081-1707106      + |   2.16667
#>                                                     normTandem     nchar
#>                                                       <factor> <integer>
#>      [1] AACCCT                                                        6
#>      [2] AACCCTAACCCTAACCCTAACCCTAACCCTAACCT                          35
#>      [3] AAACCTAGCGACAACACAGGGAGAACACTCTCACCTTAACAAGAACCCTTATT        53
#>      [4] AAAATTTTGCGCGGTTGCGGGCGGGCGCGGGGGCCGATTCC                    41
#>      [5] ACGGGCGGGGGCC                                                13
#>      ...                                                   ...       ...
#>    [996]                                          CG                   2
#>    [997]                                          AAAAC                5
#>    [998]                                          ACTAGCC              7
#>    [999]                                          AGCCT                5
#>   [1000]                                          AAAAAACTAGCC        12
#>   -------
#>   seqinfo: 1 sequence from an unspecified genome; no seqlengths

telomeres(exampleTantan, narrow="ends")
#> GRanges object with 1 range and 5 metadata columns:
#>         seqnames    ranges strand |     score normTandem     nchar    rstart
#>            <Rle> <IRanges>  <Rle> | <numeric>   <factor> <integer> <numeric>
#>   [1] 1086a8205b     1-613      + |   102.667     AACCCT         6   2232853
#>            rend
#>       <numeric>
#>   [1]   2233465
#>   -------
#>   seqinfo: 1 sequence from example genome

Citation

Below is the citation output from using citation('changchang') in R. Please run this yourself to check for any updates on how to cite changchang.

print(citation('changchang'), bibtex = TRUE)
#> To cite package 'changchang' in publications use:
#> 
#>   Plessy C (2024). _ChangChang_. doi:10.18129/B9.bioc.changchang
#>   <https://doi.org/10.18129/B9.bioc.changchang>,
#>   https://github.com//changchang - R package version 0.99.0,
#>   <http://www.bioconductor.org/packages/changchang>.
#> 
#> A BibTeX entry for LaTeX users is
#> 
#>   @Manual{,
#>     title = {ChangChang},
#>     author = {Charles Plessy},
#>     year = {2024},
#>     url = {http://www.bioconductor.org/packages/changchang},
#>     note = {https://github.com//changchang - R package version 0.99.0},
#>     doi = {10.18129/B9.bioc.changchang},
#>   }
#> 
#>   Plessy C (2024). "ChangChang." _bioRxiv_. doi:10.1101/TODO
#>   <https://doi.org/10.1101/TODO>,
#>   <https://www.biorxiv.org/content/10.1101/TODO>.
#> 
#> A BibTeX entry for LaTeX users is
#> 
#>   @Article{,
#>     title = {ChangChang},
#>     author = {Charles Plessy},
#>     year = {2024},
#>     journal = {bioRxiv},
#>     doi = {10.1101/TODO},
#>     url = {https://www.biorxiv.org/content/10.1101/TODO},
#>   }

Please note that the changchang was only made possible thanks to many other R and bioinformatics software authors, which are cited either in the vignettes and/or the paper(s) describing this package.

Code of Conduct

Please note that the changchang project is released with a Contributor Code of Conduct. By contributing to this project, you agree to abide by its terms.

Development tools

• Continuous code testing is possible thanks to GitHub actions through usethis, remotes, and rcmdcheck customized to use Bioconductor’s docker containers and BiocCheck.
• Code coverage assessment is possible thanks to codecov and covr.
• The code is styled automatically thanks to styler.
• The documentation is formatted thanks to devtools and roxygen2.

For more details, check the dev directory.

This package was developed using biocthis.