Skip to content

Commit

Permalink
Added Leung notebook
Browse files Browse the repository at this point in the history
  • Loading branch information
willbradshaw committed Apr 19, 2024
1 parent 70c1a9a commit 0f82ed9
Show file tree
Hide file tree
Showing 363 changed files with 9,619 additions and 4 deletions.
41 changes: 41 additions & 0 deletions data/2024-04-12_leung/1/adapters.fasta
Original file line number Diff line number Diff line change
@@ -0,0 +1,41 @@
>0
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>1
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
>2
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
>3
unspecified
>4
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
>5
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>6
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>7
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>8
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC
T
>9
TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>10
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
>11
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>12
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>13
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
>14
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>15
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>16
CAAGCAGAAGACGGCATACGAGAT
>17
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>18
heifigepsna
>19
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
401 changes: 401 additions & 0 deletions data/2024-04-12_leung/1/bracken_counts.tsv

Large diffs are not rendered by default.

Binary file added data/2024-04-12_leung/1/hv_clade_counts.tsv.gz
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file added data/2024-04-12_leung/1/qc_adapter_stats.tsv.gz
Binary file not shown.
Binary file added data/2024-04-12_leung/1/qc_basic_stats.tsv.gz
Binary file not shown.
Binary file not shown.
Binary file not shown.
101 changes: 101 additions & 0 deletions data/2024-04-12_leung/1/sample-metadata.csv
Original file line number Diff line number Diff line change
@@ -0,0 +1,101 @@
sample,library,country,region,city,location,instrument,date
SRR10002675,SRR10002675,Sweden,Europe,Stockholm,"Stockholm, T-centralen",SASS 3100 electret filter air sampler,2017-06-21
SRR10002676,SRR10002676,Sweden,Europe,Stockholm,"Stockholm, Slussen",SASS 3100 electret filter air sampler,2017-06-21
SRR10002677,SRR10002677,Sweden,Europe,Stockholm,"Stockholm, Medborgarplatsen",SASS 3100 electret filter air sampler,2017-06-21
SRR10002678,SRR10002678,Hong Kong,Asia,Hong Kong,"Hong Kong, Admiralty",SASS 3100 electret filter air sampler,2017-07-14
SRR10002679,SRR10002679,Hong Kong,Asia,Hong Kong,"Hong Kong, Ocean Park",SASS 3100 electret filter air sampler,2017-07-14
SRR10002680,SRR10002680,Hong Kong,Asia,Hong Kong,"Hong Kong, Fortress Hill",SASS 3100 electret filter air sampler,2017-07-14
SRR10002681,SRR10002681,Hong Kong,Asia,Hong Kong,"Hong Kong, North Point",SASS 3100 electret filter air sampler,2017-07-14
SRR10002682,SRR10002682,Hong Kong,Asia,Hong Kong,"Hong Kong, Quarry Bay",SASS 3100 electret filter air sampler,2017-07-14
SRR10002683,SRR10002683,Hong Kong,Asia,Hong Kong,"Hong Kong, Yau Tong",SASS 3100 electret filter air sampler,2017-07-14
SRR10002684,SRR10002684,Hong Kong,Asia,Hong Kong,"Hong Kong, Tsing Yi",SASS 3100 electret filter air sampler,2017-07-13
SRR10002685,SRR10002685,Hong Kong,Asia,Hong Kong,"Hong Kong, Lai King",SASS 3100 electret filter air sampler,2017-07-13
SRR10002686,SRR10002686,Hong Kong,Asia,Hong Kong,"Hong Kong, Cheung Sha Wan",SASS 3100 electret filter air sampler,2017-07-13
SRR10002687,SRR10002687,Hong Kong,Asia,Hong Kong,"Hong Kong, Sham Shui Po",SASS 3100 electret filter air sampler,2017-07-13
SRR10002688,SRR10002688,uncalculated,uncalculated,,"Hong Kong, Sham Shui Po",SASS 3100 electret filter air sampler,2017-06-21
SRR10002689,SRR10002689,USA,North America,Denver,"Denver, Denver Airport",SASS 3100 electret filter air sampler,2017-06-23
SRR10002690,SRR10002690,USA,North America,Denver,"Denver, Train Cabin - Back wagon",SASS 3100 electret filter air sampler,2017-06-23
SRR10002691,SRR10002691,USA,North America,Denver,"Denver, Boulder Junction",SASS 3100 electret filter air sampler,2017-06-22
SRR10002692,SRR10002692,USA,North America,Denver,"Denver, Boulder Junction",SASS 3100 electret filter air sampler,2017-06-22
SRR10002693,SRR10002693,USA,North America,Denver,"Denver, Boulder Junction",SASS 3100 electret filter air sampler,2017-06-22
SRR10002694,SRR10002694,USA,North America,Denver,"Denver, Denver Airport",SASS 3100 electret filter air sampler,2017-06-23
SRR10002695,SRR10002695,Norway,Europe,Oslo,"Oslo, Nydalen",Bobcat ACD-200 electret filter air sampler,2017-06-21
SRR10002696,SRR10002696,Norway,Europe,Oslo,"Oslo, Loeren",Bobcat ACD-200 electret filter air sampler,2017-06-21
SRR10002697,SRR10002697,USA,North America,Denver,"Denver, Boulder Junction",SASS 3100 electret filter air sampler,2017-06-22
SRR10002698,SRR10002698,USA,North America,Denver,"Denver, Boulder Junction",SASS 3100 electret filter air sampler,2017-06-22
SRR10002699,SRR10002699,United Kingdom,Europe,London,"London, Warren Street",SASS 3100 electret filter air sampler,2017-07-23
SRR10002700,SRR10002700,United Kingdom,Europe,London,"London, Warren Street",SASS 3100 electret filter air sampler,2017-08-21
SRR10002701,SRR10002701,United Kingdom,Europe,London,"London, Green Park",SASS 3100 electret filter air sampler,2017-08-18
SRR10002702,SRR10002702,Norway,Europe,Oslo,"Oslo, Forskningsparken",SASS 3100 electret filter air sampler,2017-06-23
SRR10002703,SRR10002703,United Kingdom,Europe,London,"London, Green Park",SASS 3100 electret filter air sampler,2017-06-21
SRR10002704,SRR10002704,Norway,Europe,Oslo,"Oslo, Majorstua",SASS 3100 electret filter air sampler,2017-06-23
SRR10002705,SRR10002705,Norway,Europe,Oslo,"Oslo, Toeyen",SASS 3100 electret filter air sampler,2017-06-23
SRR10002706,SRR10002706,Norway,Europe,Oslo,"Oslo, Helsfyr",SASS 3100 electret filter air sampler,2017-06-23
SRR10002707,SRR10002707,Norway,Europe,Oslo,"Oslo, Lindeberg",SASS 3100 electret filter air sampler,2017-06-23
SRR10002708,SRR10002708,Norway,Europe,Oslo,"Oslo, Ellingsrudaasen",SASS 3100 electret filter air sampler,2017-06-23
SRR10002709,SRR10002709,Norway,Europe,Oslo,"Oslo, Montebello",SASS 3100 electret filter air sampler,2017-06-23
SRR10002710,SRR10002710,Norway,Europe,Oslo,"Oslo, Nationaltheateret",SASS 3100 electret filter air sampler,2017-06-23
SRR10002711,SRR10002711,Norway,Europe,Oslo,"Oslo, Stortinget",SASS 3100 electret filter air sampler,2017-06-23
SRR10002712,SRR10002712,Norway,Europe,Oslo,"Oslo, Jernbanetorget",SASS 3100 electret filter air sampler,2017-06-23
SRR10002713,SRR10002713,United Kingdom,Europe,London,"London, Finsbury Park",SASS 3100 electret filter air sampler,2017-06-21
SRR10002714,SRR10002714,United Kingdom,Europe,London,"London, Highbury & Islington",SASS 3100 electret filter air sampler,2017-08-18
SRR10002715,SRR10002715,United Kingdom,Europe,London,"London, Kings Cross St Pancras",SASS 3100 electret filter air sampler,2017-08-21
SRR10002716,SRR10002716,United Kingdom,Europe,London,"London, Kings Cross St Pancras",SASS 3100 electret filter air sampler,2017-07-23
SRR10002717,SRR10002717,United Kingdom,Europe,London,"London, Warren Street",SASS 3100 electret filter air sampler,2017-06-21
SRR10002718,SRR10002718,United Kingdom,Europe,London,"London, Finsbury Park",SASS 3100 electret filter air sampler,2017-08-18
SRR10002719,SRR10002719,United Kingdom,Europe,London,"London, Pimlico",SASS 3100 electret filter air sampler,2017-08-21
SRR10002720,SRR10002720,United Kingdom,Europe,London,"London, Pimlico",SASS 3100 electret filter air sampler,2017-07-23
SRR10002721,SRR10002721,United Kingdom,Europe,London,"London, Vauxhall",SASS 3100 electret filter air sampler,2017-08-21
SRR10002722,SRR10002722,United Kingdom,Europe,London,"London, Vauxhall",SASS 3100 electret filter air sampler,2017-07-23
SRR10002723,SRR10002723,Norway,Europe,Oslo,"Oslo, Lindeberg",SASS 3100 electret filter air sampler,2017-06-27
SRR10002724,SRR10002724,Hong Kong,Asia,Hong Kong,"Hong Kong, Admiralty",SASS 3100 electret filter air sampler,2017-07-12
SRR10002725,SRR10002725,Hong Kong,Asia,Hong Kong,"Hong Kong, Ocean Park",SASS 3100 electret filter air sampler,2017-07-12
SRR10002726,SRR10002726,Norway,Europe,Oslo,"Oslo, Stortinget",SASS 3100 electret filter air sampler,2017-06-21
SRR10002727,SRR10002727,Hong Kong,Asia,Hong Kong,"Hong Kong, Cheung Sha Wan",SASS 3100 electret filter air sampler,2017-07-11
SRR10002728,SRR10002728,Hong Kong,Asia,Hong Kong,"Hong Kong, Sham Shui Po",SASS 3100 electret filter air sampler,2017-07-11
SRR10002729,SRR10002729,Hong Kong,Asia,Hong Kong,"Hong Kong, Tsing Yi",SASS 3100 electret filter air sampler,2017-07-11
SRR10002730,SRR10002730,Hong Kong,Asia,Hong Kong,"Hong Kong, Lai King",SASS 3100 electret filter air sampler,2017-07-11
SRR10002731,SRR10002731,Norway,Europe,Oslo,"Oslo, Carl Berners plass",SASS 3100 electret filter air sampler,2017-06-21
SRR10002732,SRR10002732,Hong Kong,Asia,Hong Kong,"Hong Kong, Yau Tong",SASS 3100 electret filter air sampler,2017-07-12
SRR10002733,SRR10002733,Hong Kong,Asia,Hong Kong,"Hong Kong, Fortress Hill",SASS 3100 electret filter air sampler,2017-07-12
SRR10002734,SRR10002734,Hong Kong,Asia,Hong Kong,"Hong Kong, North Point",SASS 3100 electret filter air sampler,2017-07-12
SRR10002735,SRR10002735,Hong Kong,Asia,Hong Kong,"Hong Kong, Tsim Sha Tsui",SASS 3100 electret filter air sampler,2017-07-12
SRR10002736,SRR10002736,Norway,Europe,Oslo,"Oslo, Toeyen",SASS 3100 electret filter air sampler,2017-06-27
SRR10002737,SRR10002737,USA,North America,New York City,"New York City, 63rd St.",SASS 3100 electret filter air sampler,2017-06-21
SRR10002738,SRR10002738,Norway,Europe,Oslo,"Oslo, Stortinget",SASS 3100 electret filter air sampler,2017-06-27
SRR10002739,SRR10002739,Norway,Europe,Oslo,"Oslo, Carl Berners plass",SASS 3100 electret filter air sampler,2017-06-27
SRR10002740,SRR10002740,Norway,Europe,Oslo,"Oslo, Groenland",SASS 3100 electret filter air sampler,2017-06-27
SRR10002741,SRR10002741,Norway,Europe,Oslo,"Oslo, Ellingsrudaasen",SASS 3100 electret filter air sampler,2017-06-27
SRR10002742,SRR10002742,Norway,Europe,Oslo,"Oslo, Nationaltheateret",SASS 3100 electret filter air sampler,2017-06-27
SRR10002743,SRR10002743,USA,North America,New York City,"New York City, 72nd St.",SASS 3100 electret filter air sampler,2017-06-21
SRR10002744,SRR10002744,Norway,Europe,Oslo,"Oslo, Montebello",SASS 3100 electret filter air sampler,2017-06-27
SRR10002745,SRR10002745,Norway,Europe,Oslo,"Oslo, Nationaltheateret",SASS 3100 electret filter air sampler,2017-06-26
SRR10002746,SRR10002746,Norway,Europe,Oslo,"Oslo, Montebello",SASS 3100 electret filter air sampler,2017-06-26
SRR10002747,SRR10002747,Norway,Europe,Oslo,"Oslo, Nydalen",SASS 3100 electret filter air sampler,2017-06-23
SRR10002748,SRR10002748,Norway,Europe,Oslo,"Oslo, Loeren",SASS 3100 electret filter air sampler,2017-06-23
SRR10002749,SRR10002749,Norway,Europe,Oslo,"Oslo, Vestli",SASS 3100 electret filter air sampler,2017-06-26
SRR10002750,SRR10002750,Norway,Europe,Oslo,"Oslo, Romsaas",SASS 3100 electret filter air sampler,2017-06-26
SRR10002751,SRR10002751,Norway,Europe,Oslo,"Oslo, Carl Berners plass",SASS 3100 electret filter air sampler,2017-06-26
SRR10002752,SRR10002752,Norway,Europe,Oslo,"Oslo, Groenland",SASS 3100 electret filter air sampler,2017-06-26
SRR10002753,SRR10002753,Norway,Europe,Oslo,"Oslo, Jernbanetorget",SASS 3100 electret filter air sampler,2017-06-26
SRR10002754,SRR10002754,Norway,Europe,Oslo,"Oslo, Stortinget",SASS 3100 electret filter air sampler,2017-06-26
SRR10002755,SRR10002755,United Kingdom,Europe,London,"London, Warren Street",SASS 3100 electret filter air sampler,2017-06-21
SRR10002756,SRR10002756,United Kingdom,Europe,London,"London, Oxford Circus",SASS 3100 electret filter air sampler,2017-07-23
SRR10002757,SRR10002757,United Kingdom,Europe,London,"London, Finsbury Park",SASS 3100 electret filter air sampler,2017-08-21
SRR10002758,SRR10002758,United Kingdom,Europe,London,"London, Warren Street",SASS 3100 electret filter air sampler,2017-08-18
SRR10002759,SRR10002759,United Kingdom,Europe,London,"London, Brixton",SASS 3100 electret filter air sampler,2017-08-18
SRR10002760,SRR10002760,United Kingdom,Europe,London,"London, Finsbury Park",SASS 3100 electret filter air sampler,2017-07-23
SRR10002761,SRR10002761,United Kingdom,Europe,London,"London, Highbury & Islington",SASS 3100 electret filter air sampler,2017-07-23
SRR10002762,SRR10002762,United Kingdom,Europe,London,"London, Highbury & Islington",SASS 3100 electret filter air sampler,2017-08-21
SRR10002763,SRR10002763,United Kingdom,Europe,London,"London, Vauxhall",SASS 3100 electret filter air sampler,2017-08-18
SRR10002764,SRR10002764,United Kingdom,Europe,London,"London, Highbury & Islington",SASS 3100 electret filter air sampler,2017-06-21
SRR10002765,SRR10002765,Hong Kong,Asia,Hong Kong,"Hong Kong, Shek Kip Mei",SASS 3100 electret filter air sampler,2017-07-06
SRR10002766,SRR10002766,Hong Kong,Asia,Hong Kong,"Hong Kong, Prince Edward",SASS 3100 electret filter air sampler,2017-07-06
SRR10002767,SRR10002767,Hong Kong,Asia,Hong Kong,"Hong Kong, Kowloon Tong",SASS 3100 electret filter air sampler,2017-07-06
SRR10002768,SRR10002768,Hong Kong,Asia,Hong Kong,"Hong Kong, Tai Wai",SASS 3100 electret filter air sampler,2017-07-06
SRR10002769,SRR10002769,Hong Kong,Asia,Hong Kong,"Hong Kong, Che Kung Temple",SASS 3100 electret filter air sampler,2017-07-06
SRR10002770,SRR10002770,Hong Kong,Asia,Hong Kong,"Hong Kong, Sha Tin Wai",SASS 3100 electret filter air sampler,2017-07-06
SRR10002771,SRR10002771,Hong Kong,Asia,Hong Kong,"Hong Kong, Tsim Sha Tsui",SASS 3100 electret filter air sampler,2017-07-05
SRR10002772,SRR10002772,Hong Kong,Asia,Hong Kong,"Hong Kong, East Tsim Sha Tsui",SASS 3100 electret filter air sampler,2017-07-05
SRR10002773,SRR10002773,Hong Kong,Asia,Hong Kong,"Hong Kong, Hung Hom",SASS 3100 electret filter air sampler,2017-07-05
SRR10002774,SRR10002774,Hong Kong,Asia,Hong Kong,"Hong Kong, Mong Kok East",SASS 3100 electret filter air sampler,2017-07-05
Loading

0 comments on commit 0f82ed9

Please sign in to comment.